HVCN1 (NM_001040107) Human Untagged Clone

CAT#: SC310924

HVCN1 (untagged)-Human hydrogen voltage-gated channel 1 (HVCN1), transcript variant 1


  "NM_001040107" in other vectors (6)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "HVCN1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HVCN1
Synonyms HV1; VSOP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001040107, the custom clone sequence may differ by one or more nucleotides


ATGGCCACCTGGGACGAAAAGGCAGTCACCCGCAGGGCCAAGGTGGCTCCCGCTGAGAGGATGAGCAAGT
TCTTAAGGCACTTCACGGTCGTGGGAGACGACTACCATGCCTGGAACATCAACTACAAGAAATGGGAGAA
TGAAGAGGAGGAGGAGGAGGAGGAGCAGCCACCACCCACACCAGTCTCAGGCGAGGAAGGCAGAGCTGCA
GCCCCTGACGTTGCCCCTGCCCCTGGCCCCGCACCCAGGGCCCCCCTTGACTTCAGGGGCATGTTGAGGA
AACTGTTCAGCTCCCACAGGTTTCAGGTCATCATCATCTGCTTGGTGGTTCTGGATGCCCTCCTGGTGCT
TGCTGAGCTCATCCTGGACCTGAAGATCATCCAGCCCGACAAGAATAACTATGCTGCCATGGTATTCCAC
TACATGAGCATCACCATCTTGGTCTTTTTTATGATGGAGATCATCTTTAAATTATTTGTCTTCCGCCTGG
AGTTCTTTCACCACAAGTTTGAGATCCTGGATGCCGTCGTGGTGGTGGTCTCATTCATCCTCGACATTGT
CCTCCTGTTCCAGGAGCACCAGTTTGAGGCTCTGGGCCTGCTGATTCTGCTCCGGCTGTGGCGGGTGGCC
CGGATCATCAATGGGATTATCATCTCAGTTAAGACACGTTCAGAACGGCAACTCTTAAGGTTAAAACAGA
TGAATGTACAATTGGCCGCCAAGATTCAACACCTTGAGTTCAGCTGCTCTGAGAAGGAACAAGAAATTGA
AAGACTTAACAAACTATTGCGACAGCATGGACTTCTTGGTGAAGTGAACTAG


Restriction Sites SgfI-MluI     
ACCN NM_001040107
ORF Size 822 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001040107.1, NP_001035196.1
RefSeq Size 1736
RefSeq ORF 822
Locus ID 84329
Protein Families Druggable Genome, Transmembrane
Gene Summary This gene encodes a voltage-gated protein channel protein expressed more highly in certain cells of the immune system. Phagocytic cells produce superoxide anions which require this channel protein, and in B cells this same process facilitates antibody production. This same channel protein, however, can also regulate functions in other cells including spermatozoa. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Transcript Variant: This variant (1) represents the longest transcript and encodes the shorter protein (isoform 1). Variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.