CD83 (NM_001040280) Human Untagged Clone

CAT#: SC310981

CD83 (untagged)-Human CD83 molecule (CD83), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CD83
• Synonyms: BL11; HB15
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_001040280 edited
  ATGTCGCGCGGCCTCCAGCTTCTGCTCCTGAGCTGCGCCTACAGCCTGGCTCCCGCGACG
  CCGGAGGTGAAGGTGGCTTGCTCCGAAGATGTGGACTTGCCCTGCACCGCCCCCTGGGAT
  CCGCAGGTTCCCTACACGGTCTCCTGGGTCAAGTTATTGGAGGGTGGTGAAGAGAGGATG
  GAGACACCCCAGGAAGACCACCTCAGAGGACAGCACTATCATCAGAAGGGGCAAAATGGT
  TCTTTCGACGCCCCCAATGAAAGGCCCTATTCCCTGAAGATCCGAAACACTACCAGCTGC
  AACTCGGGGACATACAGGTGCACTCTGCAGGACCCGGATGGGCAGAGAAACCTAAGTGGC
  AAGGTGATCTTGAGAGTGACAGGATGCCCTGCACAGCGTAAAGAAGAGACTTTTAAGAAA
  TACAGAGCGGAGATTGTCCTGCTGCTGGCTCTGGTTATTTTCTACTTAACACTCATCATT
  TTCACTTGTTTTGCACGGCTACAGAGTATCTTCCCAGATTTTTCTAAAGCTGGCATGGAA
  CGAGCTTTTCTCCCAGTTACCTCCCCAAATAAGCATTTAGGGCTAGTGACTCCTCACAAG
  ACAGAACTGGTATGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001040280
• ORF Size: 615 bp
• Insert Size: 2100
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001040280.1, NP_001035370.1
• RefSeq Size: 2475
• RefSeq ORF: 615
• Locus ID: 9308
• Protein Families: Transmembrane
• Gene Summary: The protein encoded by this gene is a single-pass type I membrane protein and member of the immunoglobulin superfamily of receptors. The encoded protein may be involved in the regulation of antigen presentation. A soluble form of this protein can bind to dendritic cells and inhibit their maturation. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
  Transcript Variant: This variant (2) uses an alternate in-frame splice junction at the 5' end of an exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is 1 aa shorter compared to isoform a.