NKAIN2 (NM_001040214) Human Untagged Clone

CAT#: SC310985

NKAIN2 (untagged)-Human Na+/K+ transporting ATPase interacting 2 (NKAIN2), transcript variant 1


  "NM_001040214" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "NKAIN2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NKAIN2
Synonyms FAM77B; NKAIP2; TCBA; TCBA1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_001040214 edited
ATGGGTTATTGCAGTGGCAGGTGCACGCTTATCTTTATCTGTGGCATGCAACTGGTTTGT
GTGCTGGAGAGGCAAATATTTGACTTCCTTGGATATCAGTGGGCACCTATCCTGGCAAAT
TTTGTACATATTATTATCGTCATTCTTGGTTTGTTTGGAACTATTCAATATAGACCTCGT
TACATAACAGGATATGCTGTCTGGCTAGTCCTCTGGGTTACGTGGAATGTGTTTGTTATC
TGCTTCTATTTGGAGGCTGGGGACCTCTCAAAGGAAACAGACCTTATCCTGACTTTTAAT
ATATCAATGCACCGATCTTGGTGGATGGAGAATGGACCAGGATGTACGGTGACGTCAGTG
ACACCTGCCCCAGACTGGGCCCCAGAAGACCATCGCTACATCACGGTCTCAGGGTGTTTG
CTGGAGTACCAGTACATAGAAGTGGCTCATAGTTCCCTCCAGATTGTCCTCGCACTGGCA
GGTTTCATCTACGCCTGTTATGTTGTGAAATGTATAACTGAAGAAGAGGACAGCTTTGAT
TTCATAGGTGGCTTTGACTCTTATGGCTATCAAGGGCCTCAGAAGACATCTCATTTACAA
CTACAGCCTATGTACATGTCAAAATAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites Please inquire     
ACCN NM_001040214
ORF Size 627 bp
Insert Size 600
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001040214.1, NP_001035304.1
RefSeq Size 3315
RefSeq ORF 627
Locus ID 154215
Protein Families Transmembrane
Gene Summary This gene encodes a transmembrane protein that interacts with the beta subunit of a sodium/potassium-transporting ATPase. A chromosomal translocation involving this gene is a cause of lymphoma. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.