H2AFY (NM_001040158) Human Untagged Clone

CAT#: SC310989

H2AFY (untagged)-Human H2A histone family, member Y (H2AFY), transcript variant 4


  "NM_001040158" in other vectors (4)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "H2AFY"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol H2AFY
Synonyms H2A.y; H2A/y; H2AF12M; MACROH2A1.1; macroH2A1.2; mH2A1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001040158, the custom clone sequence may differ by one or more nucleotides


ATGTCGAGCCGCGGTGGGAAGAAGAAGTCCACCAAGACGTCCAGGTCTGCCAAAGCAGGAGTCATCTTTC
CCGTGGGGCGGATGCTGCGGTACATCAAGAAAGGCCACCCCAAGTACAGGATTGGAGTGGGGGCACCCGT
GTACATGGCCGCCGTCCTGGAATACCTGACAGCGGAGATTCTGGAGCTGGCTGGCAATGCAGCGAGAGAC
AACAAGAAGGGACGGGTCACACCCCGGCACATCCTGCTGGCTGTGGCCAATGATGAAGAGCTGAATCAGC
TGCTAAAAGGAGTCACCATAGCCAGTGGGGGTGTGTTACCCAACATCCACCCCGAGTTGCTAGCGAAGAA
GCGGGGATCCAAAGGAAAGTTGGAAGCCATCATCACACCACCCCCAGCCAAAAAGGCCAAGTCTCCATCC
CAGAAGAAGCCTGTATCTAAAAAAGCAGGAGGCAAGAAAGGGGCCCGGAAATCCAAGAAGCAGGGTGAAG
TCAGTAAGGCAGCCAGCGCCGACAGCACAACCGAGGGCACACCTGCCGACGGCTTCACAGTCCTCTCCAC
CAAGAGCCTCTTCCTTGGCCAGAAGCTGAACCTTATTCACAGTGAAATCAGTAATTTAGCCGGCTTTGAG
GTGGAGGCCATAATCAATCCTACCAATGCTGACATTGACCTTAAAGATGACCTAGGAAACACGCTGGAGA
AGAAAGGTGGCAAGGAGTTTGTGGAAGCTGTCCTGGAACTCCGGAAAAAGAACGGGCCCTTGGAAGTAGC
TGGAGCTGCTGTCAGCGCAGGCCATGGCCTGCCTGCCAAGTTTGTGATCCACTGTAATAGTCCAGTTTGG
GGTGCAGACAAGTGTGAAGAACTTCTGGAAAAGACAGTGAAAAACTGCTTGGCCCTGGCTGATGATAAGA
AGCTGAAATCCATTGCATTTCCATCCATCGGCAGCGGCAGGAACGGTTTTCCAAAGCAGACAGCAGCTCA
GCTGATTCTGAAGGCCATCTCCAGTTACTTCGTGTCTACAATGTCCTCTTCCATCAAAACGGTGTACTTC
GTGCTTTTTGACAGCGAGAGTATAGGCATCTATGTGCAGGAAATGGCCAAGCTGGACGCCAACTAG


Restriction Sites SgfI-MluI     
ACCN NM_001040158
ORF Size 1116 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001040158.1, NP_001035248.1
RefSeq Size 1937
RefSeq ORF 1116
Locus ID 9555
Protein Pathways Systemic lupus erythematosus
Gene Summary Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a replication-independent histone that is a member of the histone H2A family. It replaces conventional H2A histones in a subset of nucleosomes where it represses transcription and participates in stable X chromosome inactivation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]
Transcript Variant: This variant (4) uses an alternate splice site in its coding region, compared to variant 3. This results in a protein (isoform 2) that is a single amino acid shorter than isoform 3. Variants 2 and 4 encode the same isoform (2).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.