Lunatic Fringe (LFNG) (NM_001040168) Human Untagged Clone
CAT#: SC310999
LFNG (untagged)-Human LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase (LFNG), transcript variant 2
"NM_001040168" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | LFNG |
Synonyms | SCDO3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001040168, the custom clone sequence may differ by one or more nucleotides
ATGCTCAAGCGCTGCGGCCGGCGCCTGCTGCTGGCGCTGGCGGGCGCGCTGCTCGCCTGCCTGCTGGTGC TCACCGCCGACCCGCCGCCGCCTCCACTGCCCGCCGAGCGCGGCCGGCGCGCGCTGCGCAGCCTGGCGGG CCCCGCGGGGGCTGCCCCGGCGCCCGGGCTGGGGGCGGCGGCGGCGGCGCCCGGGGCGCTGGTCCGCGAC GTGCACAGTCTGTCCGAGTACTTCAGCCTGCTCACCCGCGCGCGCAGAGATGCGGGCCCGCCGCCCGGGG CTGCCCCCCGCCCCGCCGACGGCCACCCGCGCCCCCTGGCCGAGCCGCTCGCGCCCCGAGACGTCTTCAT CGCTGTCAAGACCACCAAAAAGTTCCACCGCGCGCGCCTCGACCTGCTGCTGGAGACCTGGATCTCGCGC CACAAGGAGATGACGTTCATCTTCACTGACGGGGAAGATGAGGCCCTGGCCAGGCACACGGGCAACGTGG TCATCACAAACTGCTCGGCCGCCCACAGCCGCCAGGCGCTGTCCTGCAAGATGGCCGTGGAGTATGACCG CTTCATCGAGTCCGGCAGGAAGTGGTTCTGCCACGTGGACGATGACAACTACGTCAACCTGCGGGCCCTG CTGCGGCTGCTGGCCAGCTACCCGCACACGCGGGACGTCTACGTCGGCAAGCCCAGCCTGGACAGGCCCA TCCAGGCCATGGAGCGGGTCAGCGAGAACAAGGTGCGTCCTGTCCACTTCTGGTTTGCCACGGGCGGCGC TGGCTTCTGCATCAGCCGTGGGCTGGCTCTGAAGATGAGCCCGTGGGCCAGCGGGGGTCACTTCATGAAT ACGGCTGAGCGGATCCGGCTGCCTGATGACTGCACCATCGGCTACATCGTGGAGGCCCTGCTGGGTGTGC CCCTCATCCGCAGCGGCCTCTTCCACTCCCACCTGGAGAACCTGCAGCAGGTGCCCACCTCGGAGCTCCA CGAGCAGGTGACGCTGAGCTACGGTATGTTTGAAAACAAGCGGAACGCCGTCCACGTGAAGGGGCCCTTC TCGGTGGAGGCCGACCCATCCAGGTGGGGAAACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001040168 |
ORF Size | 1086 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001040168.1, NP_001035258.1 |
RefSeq Size | 1403 |
RefSeq ORF | 1086 |
Locus ID | 3955 |
Protein Families | Transmembrane |
Protein Pathways | Notch signaling pathway |
Gene Summary | This gene is a member of the glycosyltransferase 31 gene family. Members of this gene family, which also includes the MFNG (GeneID: 4242) and RFNG (GeneID: 5986) genes, encode evolutionarily conserved glycosyltransferases that act in the Notch signaling pathway to define boundaries during embryonic development. While their genomic structure is distinct from other glycosyltransferases, these proteins have a fucose-specific beta-1,3-N-acetylglucosaminyltransferase activity that leads to elongation of O-linked fucose residues on Notch, which alters Notch signaling. The protein encoded by this gene is predicted to be a single-pass type II Golgi membrane protein but it may also be secreted and proteolytically processed like the related proteins in mouse and Drosophila (PMID: 9187150). Mutations in this gene have been associated with autosomal recessive spondylocostal dysostosis 3. [provided by RefSeq, May 2018] Transcript Variant: This variant (2) includes an alternate 3' terminal exon compared to variant 1. The resulting protein (isoform b) is shorter and has a distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223354 | LFNG (Myc-DDK-tagged)-Human LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase (LFNG), transcript variant 2 |
USD 420.00 |
|
RG223354 | LFNG (GFP-tagged) - Human LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase (LFNG), transcript variant 2 |
USD 460.00 |
|
RC223354L3 | Lenti-ORF clone of LFNG (Myc-DDK-tagged)-Human LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase (LFNG), transcript variant 2 |
USD 620.00 |
|
RC223354L4 | Lenti-ORF clone of LFNG (mGFP-tagged)-Human LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase (LFNG), transcript variant 2 |
USD 768.00 |
{0} Product Review(s)
Be the first one to submit a review