CDC42 (NM_001039802) Human Untagged Clone
CAT#: SC311054
CDC42 (untagged)-Human cell division cycle 42 (GTP binding protein, 25kDa) (CDC42), transcript variant 3
"NM_001039802" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CDC42 |
Synonyms | CDC42Hs; G25K; TKS |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001039802, the custom clone sequence may differ by one or more nucleotides
ATGCAGACAATTAAGTGTGTTGTTGTGGGCGATGGTGCTGTTGGTAAAACATGTCTCCTGATATCCTACA CAACAAACAAATTTCCATCGGAATATGTACCGACTGTTTTTGACAACTATGCAGTCACAGTTATGATTGG TGGAGAACCATATACTCTTGGACTTTTTGATACTGCAGGGCAAGAGGATTATGACAGATTACGACCGCTG AGTTATCCACAAACAGATGTATTTCTAGTCTGTTTTTCAGTGGTCTCTCCATCTTCATTTGAAAACGTGA AAGAAAAGTGGGTGCCTGAGATAACTCACCACTGTCCAAAGACTCCTTTCTTGCTTGTTGGGACTCAAAT TGATCTCAGAGATGACCCCTCTACTATTGAGAAACTTGCCAAGAACAAACAGAAGCCTATCACTCCAGAG ACTGCTGAAAAGCTGGCCCGTGACCTGAAGGCTGTCAAGTATGTGGAGTGTTCTGCACTTACACAGAAAG GCCTAAAGAATGTATTTGACGAAGCAATATTGGCTGCCCTGGAGCCTCCAGAACCGAAGAAGAGCCGCAG GTGTGTGCTGCTATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001039802 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001039802.1, NP_001034891.1 |
RefSeq Size | 2308 bp |
RefSeq ORF | 576 bp |
Locus ID | 998 |
Cytogenetics | 1p36.12 |
Protein Families | Druggable Genome |
Protein Pathways | Adherens junction, Axon guidance, Chemokine signaling pathway, Endocytosis, Epithelial cell signaling in Helicobacter pylori infection, Fc gamma R-mediated phagocytosis, Focal adhesion, GnRH signaling pathway, Leukocyte transendothelial migration, MAPK signaling pathway, Neurotrophin signaling pathway, Pancreatic cancer, Pathogenic Escherichia coli infection, Pathways in cancer, Regulation of actin cytoskeleton, Renal cell carcinoma, T cell receptor signaling pathway, Tight junction, VEGF signaling pathway |
Gene Summary | 'The protein encoded by this gene is a small GTPase of the Rho-subfamily, which regulates signaling pathways that control diverse cellular functions including cell morphology, migration, endocytosis and cell cycle progression. This protein is highly similar to Saccharomyces cerevisiae Cdc 42, and is able to complement the yeast cdc42-1 mutant. The product of oncogene Dbl was reported to specifically catalyze the dissociation of GDP from this protein. This protein could regulate actin polymerization through its direct binding to Neural Wiskott-Aldrich syndrome protein (N-WASP), which subsequently activates Arp2/3 complex. Alternative splicing of this gene results in multiple transcript variants. Pseudogenes of this gene have been identified on chromosomes 3, 4, 5, 7, 8 and 20. [provided by RefSeq, Apr 2013]' Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1 and 3 encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219153 | CDC42 (Myc-DDK-tagged)-Human cell division cycle 42 (GTP binding protein, 25kDa) (CDC42), transcript variant 3 |
USD 420.00 |
|
RG219153 | CDC42 (GFP-tagged) - Human cell division cycle 42 (GTP binding protein, 25kDa) (CDC42), transcript variant 3 |
USD 460.00 |
|
RC219153L3 | Lenti ORF clone of Human cell division cycle 42 (GTP binding protein, 25kDa) (CDC42), transcript variant 3, Myc-DDK-tagged |
USD 620.00 |
|
RC219153L4 | Lenti ORF clone of Human cell division cycle 42 (GTP binding protein, 25kDa) (CDC42), transcript variant 3, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review