RSPO4 (NM_001040007) Human Untagged Clone

CAT#: SC311064

RSPO4 (untagged)-Human R-spondin family, member 4 (RSPO4), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RSPO4
• Synonyms: C20orf182; CRISTIN4
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_001040007 edited
  GCCCTTGCCCGGATCCGGCTGCCCAGATGCGGGCGCCACTCTGCCTGCTCCTGCTCGTCG
  CCCACGCCGTGGACATGCTCGCCCTGAACCGAAGGAAGAAGCAAGTGGGCACTGGCCTGG
  GGGGCAACTGCACAGGCTGTATCATCTGCTCAGAGGAGAACGGCTGTTCCACCTGCCAGC
  AGAGGCTCTTCCTGTTCATCCGCCGGGAAGGCATCCGCCAGTACGGCAAGTGCCTGCACG
  ACTGTCCCCCTGGGTACTTCGGCATCCGCGGCCAGGAGGTCAACAGGTGC:AAAAAATGT
  GGGGCCACTTGTGAGAGCTGCTTCAGCCAGGACTTCTGCATCCGGTGCAAGAGGCAGTTT
  TACTTGTACAAGGGGAAGTGTCTGCCCACCTGCCCGCCGGGCACTTTGGCCCACCAGAAC
  ACACGGGAGTGCCAGGAGAGGAGCCCCGGCCAGAAGAAGGGCAGGAAGGACCGGCGCCCA
  CGCAAGGACAGGAAGCTGGACCGCAGGCTGGACGTGAGGCCGCGCCAGCCCGGCCTGCAG
  CCCTGACCGCCGGCTCTCCCGACTCTCTGGTCCTAGTCCTCGGAAGGGC
  
• Restriction Sites: Please inquire
• ACCN: NM_001040007
• ORF Size: 519 bp
• Insert Size: 600
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001040007.1.

Reference Data

• RefSeq: NM_001040007.1, NP_001035096.1
• RefSeq Size: 2536
• RefSeq ORF: 519
• Locus ID: 343637
• Protein Families: Secreted Protein
• Gene Summary: This gene encodes a member of the R-spondin family of proteins that share a common domain organization consisting of a signal peptide, cysteine-rich/furin-like domain, thrombospondin domain and a C-terminal basic region. The encoded protein may be involved in activation of Wnt/beta-catenin signaling pathways. Mutations in this gene are associated with anonychia congenital. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
  Transcript Variant: This variant (2) lacks an in-frame exon in the coding region, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.