FAM3C (NM_001040020) Human Untagged Clone

CAT#: SC311065

FAM3C (untagged)-Human family with sequence similarity 3, member C (FAM3C), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FAM3C
• Synonyms: GS3786; ILEI
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001040020, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGGGTAGCAGGTGCTGCAAAGTTGGTGGTAGCTGTGGCAGTGTTTTTACTGACATTTTATGTTATTT
  CTCAAGTATTTGAAATAAAAATGGATGCAAGTTTAGGAAATCTATTTGCAAGATCAGCATTGGACACAGC
  TGCACGTTCTACAAAGCCTCCCAGATATAAGTGTGGGATCTCAAAAGCTTGCCCTGAGAAGCATTTTGCT
  TTTAAAATGGCAAGTGGAGCAGCCAACGTGGTGGGACCCAAAATCTGCCTGGAAGATAATGTTTTAATGA
  GTGGTGTTAAGAATAATGTTGGAAGAGGGATCAATGTTGCCTTGGCAAATGGAAAAACAGGAGAAGTATT
  AGACACTAAATATTTTGACATGTGGGGAGGAGATGTGGCACCATTTATTGAGTTTCTGAAGGCCATACAA
  GATGGAACAATAGTTTTAATGGGAACATACGATGATGGAGCAACCAAACTCAATGATGAGGCACGGCGGC
  TCATTGCTGATTTGGGGAGCACATCTATTACTAATCTTGGTTTTAGAGACAACTGGGTCTTCTGTGGTGG
  GAAGGGCATTAAGACAAAAAGCCCTTTTGAACAGCACATAAAGAACAATAAGGATACAAACAAATATGAA
  GGATGGCCTGAAGTTGTAGAAATGGAAGGATGCATCCCCCAGAAGCAAGACTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001040020
• ORF Size: 684 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001040020.1, NP_001035109.1
• RefSeq Size: 2512
• RefSeq ORF: 684
• Locus ID: 10447
• Protein Families: Secreted Protein, Transmembrane
• Gene Summary: This gene is a member of the family with sequence similarity 3 (FAM3) family and encodes a secreted protein with a GG domain. A change in expression of this protein has been noted in pancreatic cancer-derived cells. [provided by RefSeq, Mar 2010]
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein.