CD53 (NM_001040033) Human Untagged Clone

CAT#: SC311072

CD53 (untagged)-Human CD53 molecule (CD53), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CD53
• Synonyms: MOX44; TSPAN25
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001040033, the custom clone sequence may differ by one or more nucleotides
  ATGGGCATGAGTAGCTTGAAACTGCTGAAGTATGTCCTGTTTTTCTTCAACTTGCTCTTT
  TGGATCTGTGGCTGCTGCATTTTGGGCTTTGGGATCTACCTGCTGATCCACAACAACTTC
  GGAGTGCTCTTCCATAACCTCCCCTCCCTCACGCTGGGCAATGTGTTTGTCATCGTGGGC
  TCTATTATCATGGTAGTTGCCTTCCTGGGCTGCATGGGCTCTATCAAGGAAAACAAGTGT
  CTGCTTATGTCGTTCTTCATCCTGCTGCTGATTATCCTCCTTGCTGAGGTGACCTTGGCC
  ATCCTGCTCTTTGTATATGAACAGAAGCTGAATGAGTATGTGGCTAAGGGTCTGACCGAC
  AGCATCCACCGTTACCACTCAGACAATAGCACCAAGGCAGCGTGGGACTCCATCCAGTCA
  TTTCTGCAGTGTTGTGGTATAAATGGCACGAGTGATTGGACCAGTGGCCCACCAGCATCT
  TGCCCCTCAGATCGAAAAGTGGAGGGTTGCTATGCGAAAGCAAGACTGTGGTTTCATTCC
  AATTTCCTGTATATCGGAATCATCACCATCTGTGTATGTGTGATTGAGGTGTTGGGGATG
  TCCTTTGCACTGACCCTGAACTGCCAGATTGACAAAACCAGCCAGACCATAGGGCTATGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001040033
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001040033.1, NP_001035122.1
• RefSeq Size: 1572 bp
• RefSeq ORF: 660 bp
• Locus ID: 963
• Cytogenetics: 1p13.3
• Protein Families: Transmembrane
• Gene Summary: 'The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that is known to complex with integrins. It contributes to the transduction of CD2-generated signals in T cells and natural killer cells and has been suggested to play a role in growth regulation. Familial deficiency of this gene has been linked to an immunodeficiency associated with recurrent infectious diseases caused by bacteria, fungi and viruses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]'
  Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein.