MAPKAP Kinase 2 (MAPKAPK2) (NM_004759) Human Untagged Clone
CAT#: SC311111
MAPKAPK2 (untagged)-Human mitogen-activated protein kinase-activated protein kinase 2 (MAPKAPK2), transcript variant 1
"NM_004759" in other vectors (7)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MAPKAPK2 |
Synonyms | MAPKAP-K2; MK-2; MK2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_004759, the custom clone sequence may differ by one or more nucleotides
ATGCTGTCCAACTCCCAGGGCCAGAGCCCGCCGGTGCCGTTCCCCGCCCCGGCCCCGCCGCCGCAGCCCC CCACCCCTGCCCTGCCGCACCCCCCGGCGCAGCCGCCGCCGCCGCCCCCGCAGCAGTTCCCGCAGTTCCA CGTCAAGTCCGGCCTGCAGATCAAGAAGAACGCCATCATCGATGACTACAAGGTCACCAGCCAGGTCCTG GGGCTGGGCATCAACGGCAAAGTTTTGCAGATCTTCAACAAGAGGACCCAGGAGAAATTCGCCCTCAAAA TGCTTCAGGACTGCCCCAAGGCCCGCAGGGAGGTGGAGCTGCACTGGCGGGCCTCCCAGTGCCCGCACAT CGTACGGATCGTGGATGTGTACGAGAATCTGTACGCAGGGAGGAAGTGCCTGCTGATTGTCATGGAATGT TTGGACGGTGGAGAACTCTTTAGCCGAATCCAGGATCGAGGAGACCAGGCATTCACAGAAAGAGAAGCAT CCGAAATCATGAAGAGCATCGGTGAGGCCATCCAGTATCTGCATTCAATCAACATTGCCCATCGGGATGT CAAGCCTGAGAATCTCTTATACACCTCCAAAAGGCCCAACGCCATCCTGAAACTCACTGACTTTGGCTTT GCCAAGGAAACCACCAGCCACAACTCTTTGACCACTCCTTGTTATACACCGTACTATGTGGCTCCAGAAG TGCTGGGTCCAGAGAAGTATGACAAGTCCTGTGACATGTGGTCCCTGGGTGTCATCATGTACATCCTGCT GTGTGGGTATCCCCCCTTCTACTCCAACCACGGCCTTGCCATCTCTCCGGGCATGAAGACTCGCATCCGA ATGGGCCAGTATGAATTTCCCAACCCAGAATGGTCAGAAGTATCAGAGGAAGTGAAGATGCTCATTCGGA ATCTGCTGAAAACAGAGCCCACCCAGAGAATGACCATCACCGAGTTTATGAACCACCCTTGGATCATGCA ATCAACAAAGGTCCCTCAAACCCCACTGCACACCAGCCGGGTCCTGAAGGAGGACAAGGAGCGGTGGGAG GATGTCAAGGGGTGTCTTCATGACAAGAACAGCGACCAGGCCACTTGGCTGACCAGGTTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_004759 |
ORF Size | 1113 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_004759.4, NP_004750.1 |
RefSeq Size | 3534 |
RefSeq ORF | 1113 |
Locus ID | 9261 |
Domains | pkinase, TyrKc, S_TKc |
Protein Families | Druggable Genome, Protein Kinase |
Protein Pathways | MAPK signaling pathway, Neurotrophin signaling pathway, VEGF signaling pathway |
Gene Summary | This gene encodes a member of the Ser/Thr protein kinase family. This kinase is regulated through direct phosphorylation by p38 MAP kinase. In conjunction with p38 MAP kinase, this kinase is known to be involved in many cellular processes including stress and inflammatory responses, nuclear export, gene expression regulation and cell proliferation. Heat shock protein HSP27 was shown to be one of the substrates of this kinase in vivo. Two transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longer transcript but encodes the shorter isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC323636 | MAPKAPK2 (untagged)-Kinase deficient mutant (K93M) of Human mitogen-activated protein kinase-activated protein kinase 2 (MAPKAPK2), transcript variant 1 |
USD 640.00 |
|
RC220487 | MAPKAPK2 (Myc-DDK-tagged)-Human mitogen-activated protein kinase-activated protein kinase 2 (MAPKAPK2), transcript variant 1 |
USD 98.00 |
|
RG220487 | MAPKAPK2 (GFP-tagged) - Human mitogen-activated protein kinase-activated protein kinase 2 (MAPKAPK2), transcript variant 1 |
USD 460.00 |
|
RC220487L1 | Lenti ORF clone of Human mitogen-activated protein kinase-activated protein kinase 2 (MAPKAPK2), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
RC220487L2 | Lenti ORF clone of Human mitogen-activated protein kinase-activated protein kinase 2 (MAPKAPK2), transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC220487L3 | Lenti ORF clone of Human mitogen-activated protein kinase-activated protein kinase 2 (MAPKAPK2), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC220487L4 | Lenti ORF clone of Human mitogen-activated protein kinase-activated protein kinase 2 (MAPKAPK2), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review