BCL2L12 (NM_001040668) Human Untagged Clone

CAT#: SC311176

BCL2L12 (untagged)-Human BCL2-like 12 (proline rich) (BCL2L12), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BCL2L12
• Synonyms: MGC120313; MGC120314; MGC120315
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001040668, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGACGGCCCGCTGGGCTGTTCCCGCCCCTATGCCCTTTTTTGGGTTTCCGGCCAGAGGCATGCTGGG
  AGCGTCACATGCAAATTGAGCGTGCACCCAGCGTTCCGCCCTTTCTACGCTGGGCCGGTTATCGACCCGG
  CCCAGTGCGCAGGCGCGGGAAAGTTGAACTAATAAAGTTTGTACGAGTTCAGTGGAGGAGACCGCAAGTT
  GAGTGGAGGAGGCGGCGGTGGGGCCCCGGACCAGGTGCCTCCATGGCAGGCTCTGAAGAGCTGGGGCTCC
  GGGAAGACACGCTGAGGGTCCTAGCTGCCTTCCTTAGGCGTGGTGAGGCTGCCGGGTCTCCTGTTCCAAC
  TCCACCTAGCCCTGCCCAAGAAGAGCCAACAGACTTCCTGAGCCGCCTTCGAAGATGTCTTCCCTGCTCC
  CTGGGGCGAGGAGCAGCCCCCTCTGAGTCCCCTCGGCCTTGCTCTCTGCCCATCCGCCCCTGCTATGGTT
  TAGAGCCTGGCCCAGCTACTCCAGACTTCTATGCTTTGGTGGCCCAGCGGCTGGAACAGCTGGTCCAAGA
  GCAGCTGAAATCTCCGCCCAGCCCAGAATTACAGGGTCCCCCATCGACAGAGAAGGAAGCCATACTGCGG
  AGGCTGGTGGCCCTGCTGGAGGAGGAGGCAGAAGTCATTAACCAGAAGCTGGCCTCGGACCCCGCCCTGC
  GCAGCAAGCTGGTCCGCCTGTCCTCCGACTCTTTCGCCCGCCTGGTGGAGCTGTTCTGTAGCCGGGATGA
  CAGCTCTCGCCCAAGCCGAGCATGCCCCGGGCCCCCGCCTCCTTCCCCGGAGCCCCTGGCCCGCCTGGCC
  CTAGCCATGGAGCTGAGCCGGCGCGTGGCCGGGCTGGGGGGCACCCTGGCCGGACTCAGCGTGGAGCACG
  TGCACAGCTTCACGCCCTGGATCCAGGCCCACGGGGGCTGGGAGGGCATCCTGGCTGTTTCACCCGTGGA
  CTTGAACTTGCCATTGGACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001040668
• ORF Size: 1002 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001040668.1, NP_001035758.1
• RefSeq Size: 1890
• RefSeq ORF: 1002
• Locus ID: 83596
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a member of a family of proteins containing a Bcl-2 homology domain 2 (BH2). The encoded protein is an anti-apoptotic factor that acts as an inhibitor of caspases 3 and 7 in the cytoplasm. In the nucleus, it binds to the p53 tumor suppressor protein, preventing its association with target genes. Overexpression of this gene has been detected in a number of different cancers. There is a pseudogene for this gene on chromosome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
  Transcript Variant: This variant (3) uses an alternate in-frame splice site, compared to variant 1. The encoded isoform (3) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.