RHBDD2 (NM_001040457) Human Untagged Clone
CAT#: SC311184
RHBDD2 (untagged)-Human rhomboid domain containing 2 (RHBDD2), transcript variant 2
"NM_001040457" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RHBDD2 |
Synonyms | NPD007; RHBDL7 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001040457, the custom clone sequence may differ by one or more nucleotides
ATGCTGGGAGTCACCACCGTCCGTTCTCGGATGAGGCGGGCCCTGGTGTTTGGCATGGTT GTGCCCTCAGTCCTGGTTCCGTGGCTCCTGCTGGGTGCCTCGTGGCTCATTCCCCAGACC TCTTTCCTCAGTAATGTCTGCGGGCTGTCCATCGGGCTGGCCTATGGCCTCACCTACTGC TATTCCATCGACCTCTCAGAGCGAGTGGCACTGAAGCTCGATCAGACCTTCCCCTTCAGC CTGATGAGGAGGATATCCGTGTTCAAGTACGTCTCAGGGTCTTCAGCCGAGAGGAGGGCA GCCCAGAGCCGGAAACTGAACCCGGTGCCTGGCTCCTACCCCACACAGAGCTGCCACCCT CACCTGTCCCCAAGCCACCCTGTGTCCCAGACGCAGCACGCCAGTGGTCAGAAGCTGGCC TCCTGGCCCTCCTGCACCCCCGGGCACATGCCCACCTTGCCTCCGTACCAGCCTGCCTCC GGCCTGTGCTATGTGCAGAACCACTTTGGTCCAAACCCCACCTCCTCCAGTGTCTACCCA GCTTCTGCGGGCACCTCCCTGGGCATCCAGCCCCCCACGCCTGTGAACAGCCCTGGCACG GTGTATTCTGGGGCCTTGGGCACACCAGGGGCTGCAGGCTCCAAGGAGTCCTCCAGGGTC CCCATGCCCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001040457 |
ORF Size | 672 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001040457.1, NP_001035547.1 |
RefSeq Size | 1878 |
RefSeq ORF | 672 |
Locus ID | 57414 |
Protein Families | Transmembrane |
Gene Summary | The protein encoded by this gene is a member of the rhomboid family of membrane-bound proteases and is overexpressed in some breast cancers. Members of this family are involved in intramembrane proteolysis. In mouse, the orthologous protein associates with the Golgi body. [provided by RefSeq, Sep 2016] Transcript Variant: This variant (2) has an alternate exon in the 5' end compared to variant 1. This difference causes translation initiation at a downstream AUG and results in an isoform (b) with a shorter N-terminus, compared to isoform a. Variants 2-4 all encode the same isoform (b). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219463 | RHBDD2 (Myc-DDK-tagged)-Human rhomboid domain containing 2 (RHBDD2), transcript variant 2 |
USD 420.00 |
|
RG219463 | RHBDD2 (GFP-tagged) - Human rhomboid domain containing 2 (RHBDD2), transcript variant 2 |
USD 460.00 |
|
RC219463L3 | Lenti-ORF clone of RHBDD2 (Myc-DDK-tagged)-Human rhomboid domain containing 2 (RHBDD2), transcript variant 2 |
USD 620.00 |
|
RC219463L4 | Lenti-ORF clone of RHBDD2 (mGFP-tagged)-Human rhomboid domain containing 2 (RHBDD2), transcript variant 2 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review