RHBDD2 (NM_001040457) Human Untagged Clone

CAT#: SC311184

RHBDD2 (untagged)-Human rhomboid domain containing 2 (RHBDD2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RHBDD2
• Synonyms: NPD007; RHBDL7
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001040457, the custom clone sequence may differ by one or more nucleotides
  ATGCTGGGAGTCACCACCGTCCGTTCTCGGATGAGGCGGGCCCTGGTGTTTGGCATGGTT
  GTGCCCTCAGTCCTGGTTCCGTGGCTCCTGCTGGGTGCCTCGTGGCTCATTCCCCAGACC
  TCTTTCCTCAGTAATGTCTGCGGGCTGTCCATCGGGCTGGCCTATGGCCTCACCTACTGC
  TATTCCATCGACCTCTCAGAGCGAGTGGCACTGAAGCTCGATCAGACCTTCCCCTTCAGC
  CTGATGAGGAGGATATCCGTGTTCAAGTACGTCTCAGGGTCTTCAGCCGAGAGGAGGGCA
  GCCCAGAGCCGGAAACTGAACCCGGTGCCTGGCTCCTACCCCACACAGAGCTGCCACCCT
  CACCTGTCCCCAAGCCACCCTGTGTCCCAGACGCAGCACGCCAGTGGTCAGAAGCTGGCC
  TCCTGGCCCTCCTGCACCCCCGGGCACATGCCCACCTTGCCTCCGTACCAGCCTGCCTCC
  GGCCTGTGCTATGTGCAGAACCACTTTGGTCCAAACCCCACCTCCTCCAGTGTCTACCCA
  GCTTCTGCGGGCACCTCCCTGGGCATCCAGCCCCCCACGCCTGTGAACAGCCCTGGCACG
  GTGTATTCTGGGGCCTTGGGCACACCAGGGGCTGCAGGCTCCAAGGAGTCCTCCAGGGTC
  CCCATGCCCTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001040457
• ORF Size: 672 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001040457.1, NP_001035547.1
• RefSeq Size: 1878
• RefSeq ORF: 672
• Locus ID: 57414
• Protein Families: Transmembrane
• Gene Summary: The protein encoded by this gene is a member of the rhomboid family of membrane-bound proteases and is overexpressed in some breast cancers. Members of this family are involved in intramembrane proteolysis. In mouse, the orthologous protein associates with the Golgi body. [provided by RefSeq, Sep 2016]
  Transcript Variant: This variant (2) has an alternate exon in the 5' end compared to variant 1. This difference causes translation initiation at a downstream AUG and results in an isoform (b) with a shorter N-terminus, compared to isoform a. Variants 2-4 all encode the same isoform (b). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.