CD3D (NM_001040651) Human Untagged Clone

CAT#: SC311200

CD3D (untagged)-Human CD3d molecule, delta (CD3-TCR complex) (CD3D), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CD3D
• Synonyms: CD3-DELTA; IMD19; T3D
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001040651, the custom clone sequence may differ by one or more nucleotides
  ATGGAACATAGCACGTTTCTCTCTGGCCTGGTACTGGCTACCCTTCTCTCGCAAGTGAGC
  CCCTTCAAGATACCTATAGAGGAACTTGAGGACAGAGTGTTTGTGAATTGCAATACCAGC
  ATCACATGGGTAGAGGGAACGGTGGGAACACTGCTCTCAGACATTACAAGACTGGACCTG
  GGAAAACGCATCCTGGACCCACGAGGAATATATAGGTGTAATGGGACAGATATATACAAG
  GACAAAGAATCTACCGTGCAAGTTCATTATCGAACTGCCGACACACAAGCTCTGTTGAGG
  AATGACCAGGTCTATCAGCCCCTCCGAGATCGAGATGATGCTCAGTACAGCCACCTTGGA
  GGAAACTGGGCTCGGAACAAGTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001040651
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001040651.1, NP_001035741.1
• RefSeq Size: 639 bp
• RefSeq ORF: 384 bp
• Locus ID: 915
• Cytogenetics: 11q23.3
• Protein Families: Druggable Genome
• Protein Pathways: Hematopoietic cell lineage, Primary immunodeficiency, T cell receptor signaling pathway
• Gene Summary: 'The protein encoded by this gene is part of the T-cell receptor/CD3 complex (TCR/CD3 complex) and is involved in T-cell development and signal transduction. The encoded membrane protein represents the delta subunit of the CD3 complex, and along with four other CD3 subunits, binds either TCR alpha/beta or TCR gamma/delta to form the TCR/CD3 complex on the surface of T-cells. Defects in this gene are a cause of severe combined immunodeficiency autosomal recessive T-cell-negative/B-cell-positive/NK-cell-positive (SCIDBNK). Two transcript variants encoding different isoforms have been found for this gene. Other variants may also exist, but the full-length natures of their transcripts has yet to be defined. [provided by RefSeq, Feb 2009]'
  Transcript Variant: This variant (2) lacks an exon in the coding region, compared to variant 1. The encoded protein (B) is shorter and lacks the transmembrane domain, compared to isoform A.