VAMP1 (NM_014231) Human Untagged Clone

CAT#: SC311201

VAMP1 (untagged)-Human vesicle-associated membrane protein 1 (synaptobrevin 1) (VAMP1), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: VAMP1
• Synonyms: CMS25; SPAX1; SYB1; VAMP-1
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_014231 edited
  CACTGAAGGATCCTCACAGCAACCGCTCCTTTCCGGAGTCGGATGAGAGGAGAGTTGTGA
  CTGGCAATTGGCAGGGGCGGGGCGGGCTAGGCCTGTAGCGCTGGGCGACCGTCCTGGGCA
  TGGATTGGGCCGCGGGGTTGTCACCGTTATCCGGGAGGCGTGGTCAGCACTAATAAAGGC
  GGAGGCCGGCGCGGCAGCTGCAGTAAGTTCCAGCGCAGCTAGACCGCGGGGTAGTCGGCG
  CGAGGCGGAGCTTGGCAGTTCCGTCCACTTCAGCCGCAGCGTCCCTCGCCGGGTGTCTCG
  CCGCAGCCTCCGGAGAGGAACAGACCCTCACTCTCTCTGTCAGAAAAATGTCTGCTCCAG
  CTCAGCCACCTGCTGAAGGGACAGAAGGGACTGCCCCAGGTGGGGGTCCCCCTGGCCCTC
  CTCCTAACATGACCAGTAACAGACGACTACAGCAAACCCAGGCACAAGTGGAGGAGGTGG
  TGGACATCATACGTGTGAACGTGGACAAGGTCCTGGAGAGGGACCAGAAGCTGTCAGAGC
  TGGATGACCGAGCTGATGCCTTGCAGGCAGGAGCATCACAATTTGAGAGCAGTGCTGCAA
  AGCTAAAGAGGAAGTATTGGTGGAAAAACTGCAAGATGATGATCATGCTGGGAGCCATCT
  GTGCCATCATCGTGGTAGTTATTGTAATCTACTTTTTTACTTGAGAATG
  
• Restriction Sites: Please inquire
• ACCN: NM_014231
• Insert Size: 700 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_014231.3, NP_055046.1
• RefSeq Size: 2748 bp
• RefSeq ORF: 357 bp
• Locus ID: 6843
• Cytogenetics: 12p13.31
• Domains: synaptobrevin
• Protein Families: Secreted Protein, Transmembrane
• Protein Pathways: SNARE interactions in vesicular transport
• Gene Summary: 'Synapotobrevins, syntaxins, and the synaptosomal-associated protein SNAP25 are the main components of a protein complex involved in the docking and/or fusion of synaptic vesicles with the presynaptic membrane. The protein encoded by this gene is a member of the vesicle-associated membrane protein (VAMP)/synaptobrevin family. Mutations in this gene are associated with autosomal dominant spastic ataxia 1. Multiple alternative splice variants have been described, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2014]'
  Transcript Variant: This variant (1), also known as VAMP-1A, encodes the longest isoform (1).