CRCP (NM_001040647) Human Untagged Clone

CAT#: SC311203

CRCP (untagged)-Human CGRP receptor component (CRCP), transcript variant 2


  "NM_001040647" in other vectors (6)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "CRCP"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CRCP
Synonyms CGRP-RCP; CGRPRCP; RCP; RCP9; RPC9
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001040647 edited
ATGGAAGTGAAGGATGCCAATTCTGCGCTTCTCAGTAACTACGAGACGTTAAAATACATA
TCAAAAACACCATGCAGGCACCAGAGTCCTGAAATTGTCAGAGAATTTCTCACAGCATTG
AAAAGCCACAAGTTGACCAAAGCTGAGAAGCTCCAGCTGCTGAACCACCGGCCTGTGACT
GCTGTGGAGATCCAGCTGATGGTGGAAGAGAGTGAAGAGCGGCTCACGGAGGAGCAGATT
GAAGCTCTTCTCCACACCGTCACCAGCATTCTGCCTGCAGAGCCAGAGGCTGAGCAGAAG
AAGAATACAAACAGCAATGTGGCAATGGACGAAGAGGACCCAGCATAG
Restriction Sites ECoRI-NOT     
ACCN NM_001040647
ORF Size 348 bp
Insert Size 300
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001040647.1, NP_001035737.1
RefSeq Size 2721
RefSeq ORF 348
Locus ID 27297
Protein Families Druggable Genome
Gene Summary This gene encodes a membrane protein that functions as part of a receptor complex for a small neuropeptide that increases intracellular cAMP levels. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an alternate in-frame exon, compared to variant 1, resulting in a shorter protein (isoform b), compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.