Neuropeptide S (NPS) (NM_001030013) Human Untagged Clone

CAT#: SC311206

NPS (untagged)-Human neuropeptide S (NPS), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NPS
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_001030013 edited
  GGAAGTCCAAAATGATTAGCTCAGTAAAACTCAATCTCATCCTAGTTCTGTCGCTGTCCA
  CAATGCATGTGTTTTGGTGTTATCCAGTTCCATCTTCTAAGGTGTCTGGAAAATCTGATT
  ACTTTCTCATTCTGCTGAACAGCTGCCCAACCAGATTGGACAGGAGCAAAGAACTAGCTT
  TTCTAAAGCCAATTTTGGAGAAGATGTTTGTGAAAAGGTCCTTTCGCAATGGAGTTGGCA
  CAGGGATGAAAAAAACTTCCTTTCAAAGAGCAAAATCATGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001030013
• Insert Size: 300 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001030013.1.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001030013.1, NP_001025184.1
• RefSeq Size: 322 bp
• RefSeq ORF: 270 bp
• Locus ID: 594857
• Cytogenetics: 10q26.2
• Protein Families: Secreted Protein