CRCP (NM_001040648) Human Untagged Clone
CAT#: SC311209
CRCP (untagged)-Human CGRP receptor component (CRCP), transcript variant 3
"NM_001040648" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CRCP |
Synonyms | CGRP-RCP; CGRPRCP; RCP; RCP9; RPC9 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001040648, the custom clone sequence may differ by one or more nucleotides
ATGGAAGTAGCTGAGAAGCTCCAGCTGCTGAACCACCGGCCTGTGACTGCTGTGGAGATC CAGCTGATGGTGGAAGAGAGTGAAGAGCGGCTCACGGAGGAGCAGATTGAAGCTCTTCTC CACACCGTCACCAGCATTCTGCCTGCAGAGCCAGAGGCTGAGCAGAAGAAGAATACAAAC AGCAATGTGGCAATGGACGAAGAGGACCCAGCATAG |
Restriction Sites | Please inquire |
ACCN | NM_001040648 |
ORF Size | 216 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001040648.1, NP_001035738.1 |
RefSeq Size | 2589 |
RefSeq ORF | 216 |
Locus ID | 27297 |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a membrane protein that functions as part of a receptor complex for a small neuropeptide that increases intracellular cAMP levels. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) lacks three consecutive exons but maintains the reading frame, compared to variant 1, resulting in a much shorter protein (isoform c), compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217080 | CRCP (Myc-DDK-tagged)-Human CGRP receptor component (CRCP), transcript variant 3 |
USD 420.00 |
|
RG217080 | CRCP (GFP-tagged) - Human CGRP receptor component (CRCP), transcript variant 3 |
USD 460.00 |
|
RC217080L3 | Lenti-ORF clone of CRCP (Myc-DDK-tagged)-Human CGRP receptor component (CRCP), transcript variant 3 |
USD 620.00 |
|
RC217080L4 | Lenti-ORF clone of CRCP (mGFP-tagged)-Human CGRP receptor component (CRCP), transcript variant 3 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review