PTPN20B (PTPN20) (NM_001042365) Human Untagged Clone
CAT#: SC311213
PTPN20B (untagged)-Human protein tyrosine phosphatase, non-receptor type 20B (PTPN20B), transcript variant 10
"NM_001042365" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PTPN20 |
Synonyms | bA42B19.1; bA142I17.1; CT126; PTPN20A; PTPN20B |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001042365, the custom clone sequence may differ by one or more nucleotides
ATGTGGACAGCCAGAGGCCCCTTCAGAAGAGACAGGTGGAGCAGTGAGGATGAGGAGGCT GCAGGGCCATCACAGGCTCTCTCCCCTCTACTTTCTGTTCAACATCATGGATATAGTGGC CCAAATGAGAGAACAACGTTCTGGCATGGTTCAAACGAAGGAGCAGTATCACTTTTGTTA CGATATTGTGCTTGA |
Restriction Sites | Please inquire |
ACCN | NM_001042365 |
ORF Size | 195 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001042365.2, NP_001035824.1 |
RefSeq Size | 1885 |
RefSeq ORF | 195 |
Locus ID | 26095 |
Protein Families | Druggable Genome, Phosphatase |
Gene Summary | The product of this gene belongs to the family of classical tyrosine-specific protein tyrosine phosphatases. Many protein tyrosine phosphatases have been shown to regulate fundamental cellular processes. The encoded protein appears to be targeted to sites of actin polymerization. A pseudogene of this gene has been defined on chromosome 10. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014] Transcript Variant: This variant (10) differs in the 5' UTR and has multiple coding region differences, compared to variant 1, one of which results in a frameshift. These differences cause translation initiation at a downstream AUG and a protein (isoform 10) with a distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223428 | PTPN20B (Myc-DDK-tagged)-Human protein tyrosine phosphatase, non-receptor type 20B (PTPN20B), transcript variant 10 |
USD 420.00 |
|
RG223428 | PTPN20B (GFP-tagged) - Human protein tyrosine phosphatase, non-receptor type 20B (PTPN20B), transcript variant 10 |
USD 460.00 |
|
RC223428L3 | Lenti-ORF clone of PTPN20B (Myc-DDK-tagged)-Human protein tyrosine phosphatase, non-receptor type 20B (PTPN20B), transcript variant 10 |
USD 620.00 |
|
RC223428L4 | Lenti-ORF clone of PTPN20B (mGFP-tagged)-Human protein tyrosine phosphatase, non-receptor type 20B (PTPN20B), transcript variant 10 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review