p8 (NUPR1) (NM_001042483) Human Untagged Clone

CAT#: SC311217

NUPR1 (untagged)-Human nuclear protein, transcriptional regulator, 1 (NUPR1), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NUPR1
• Synonyms: COM1; P8
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_001042483 edited
  CAAAGCGTTAGGAGAAGAAGAGAGGCAGGGAAGACAAGCCAGGCACGATGGCCACCTTCC
  CACCAGCAACCAGCGCCCCCCAGCAGCCCCCAGGCCCGGAGGACGAGGACTCCAGCCTGG
  ATGAATCTGACCTCTATAGCCTGGCCCATTCCTACCTCGGGCCTCTCATCATGCCTATGC
  CTACTTCACCTCTGACTCCTGCCTTGGTTACAGGAGGTGGAGGCCGGAAAGGTCGCACCA
  AGAGAGAAGCTGCTGCCAACACCAACCGCCCCAGCCCTGGCGGGCACGAGAGGAAACTGG
  TGACCAAGCTGCAGAATTCAGAGAGGAAGAAGCGAGGGGCACGGCGCTGAGACAGAGCTG
  GAGATGAGGCCAGACCATGGACACTACACCCAGCAATAGAGACGGGACTGCGGAGGAAGG
  AGGACCCAGGACAGGATCCAGGCCGGCTTGCCACACCCCCCACCCCTAGGACTTATTCCC
  GCTGACTGAGTCTCTGAGGGGCTACCAGGAAAGCGCCTCCAACCCTAGCAAAAGTGCAAG
  ATGGGGAGTGAGAGGCTGGGAATGGAGGGGCAGAGCCAGGAAGATCCCCCAGAAAAGAAA
  GCTACAGAAGAAACTGGGGCTCCTCCAGGGTGGCAGCAACAATA
  
• Restriction Sites: NotI-NotI
• ACCN: NM_001042483
• ORF Size: 303 bp
• Insert Size: 600
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001042483.1, NP_001035948.1
• RefSeq Size: 938
• RefSeq ORF: 303
• Locus ID: 26471
• Protein Families: Druggable Genome