CAVIN3 (NM_145040) Human Untagged Clone

CAT#: SC311245

PRKCDBP (untagged)-Human protein kinase C, delta binding protein (PRKCDBP)


  "NM_145040" in other vectors (7)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CAVIN3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CAVIN3
Synonyms cavin-3; HSRBC; PRKCDBP; SRBC
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_145040, the custom clone sequence may differ by one or more nucleotides


ATGAGGGAGAGTGCGTTGGAGCGGGGGCCTGTGCCCGAGGCGCCGGCGGGGGGTCCCGTGCACGCCGTGA
CGGTGGTGACCCTGCTGGAGAAGCTGGCCTCCATGCTGGAGACTCTGCGGGAGCGGCAGGGAGGCCTGGC
TCGAAGGCAGGGAGGCCTGGCAGGGTCCGTGCGCCGCATCCAGAGCGGCCTGGGCGCTCTGAGTCGCAGC
CACGACACCACCAGCAACACCTTGGCGCAGCTGCTGGCCAAGGCGGAGCGCGTGAGCTCGCACGCCAACG
CCGCCCAAGAGCGCGCGGTGCGCCGCGCAGCCCAGGTGCAGCGGCTGGAGGCCAACCACGGGCTGCTGGT
GGCGCGCGGGAAGCTCCACGTTCTGCTCTTCAAGGAGGAGGGTGAAGTCCCAGCCAGCGCTTTCCAGAAG
GCACCAGAGCCCTTGGGCCCGGCGGACCAGTCCGAGCTGGGCCCAGAGCAGCTGGAGGCCGAAGTTGGAG
AGAGCTCGGACGAGGAGCCGGTGGAGTCCAGGGCCCAGCGGCTGCGGCGCACCGGATTGCAGAAGGTACA
GAGCCTCCGAAGGGCCCTTTCGGGCCGGAAAGGCCCTGCAGCGCCACCGCCCACCCCGGTCAAGCCGCCT
CGCCTTGGGCCTGGCCGGAGCGCTGAAGCCCAGCCGGAAGCCCAGCCTGCGCTGGAGCCCACGCTGGAGC
CAGAGCCTCCGCAGGACACCGAGGAAGATCCCGGGAGACCTGGGGCTGCCGAAGAAGCTCTGCTCCAAAT
GGAGAGTGTAGCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_145040
ORF Size 786 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_145040.2, NP_659477.2
RefSeq Size 1039
RefSeq ORF 786
Locus ID 112464
Protein Families Druggable Genome
Gene Summary The protein encoded by this gene was identified as a binding protein of the protein kinase C, delta (PRKCD). The expression of this gene in cultured cell lines is strongly induced by serum starvation. The expression of this protein was found to be down-regulated in various cancer cell lines, suggesting the possible tumor suppressor function of this protein. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.