CAVIN3 (NM_145040) Human Untagged Clone
CAT#: SC311245
PRKCDBP (untagged)-Human protein kinase C, delta binding protein (PRKCDBP)
"NM_145040" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CAVIN3 |
Synonyms | cavin-3; HSRBC; PRKCDBP; SRBC |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_145040, the custom clone sequence may differ by one or more nucleotides
ATGAGGGAGAGTGCGTTGGAGCGGGGGCCTGTGCCCGAGGCGCCGGCGGGGGGTCCCGTGCACGCCGTGA CGGTGGTGACCCTGCTGGAGAAGCTGGCCTCCATGCTGGAGACTCTGCGGGAGCGGCAGGGAGGCCTGGC TCGAAGGCAGGGAGGCCTGGCAGGGTCCGTGCGCCGCATCCAGAGCGGCCTGGGCGCTCTGAGTCGCAGC CACGACACCACCAGCAACACCTTGGCGCAGCTGCTGGCCAAGGCGGAGCGCGTGAGCTCGCACGCCAACG CCGCCCAAGAGCGCGCGGTGCGCCGCGCAGCCCAGGTGCAGCGGCTGGAGGCCAACCACGGGCTGCTGGT GGCGCGCGGGAAGCTCCACGTTCTGCTCTTCAAGGAGGAGGGTGAAGTCCCAGCCAGCGCTTTCCAGAAG GCACCAGAGCCCTTGGGCCCGGCGGACCAGTCCGAGCTGGGCCCAGAGCAGCTGGAGGCCGAAGTTGGAG AGAGCTCGGACGAGGAGCCGGTGGAGTCCAGGGCCCAGCGGCTGCGGCGCACCGGATTGCAGAAGGTACA GAGCCTCCGAAGGGCCCTTTCGGGCCGGAAAGGCCCTGCAGCGCCACCGCCCACCCCGGTCAAGCCGCCT CGCCTTGGGCCTGGCCGGAGCGCTGAAGCCCAGCCGGAAGCCCAGCCTGCGCTGGAGCCCACGCTGGAGC CAGAGCCTCCGCAGGACACCGAGGAAGATCCCGGGAGACCTGGGGCTGCCGAAGAAGCTCTGCTCCAAAT GGAGAGTGTAGCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_145040 |
ORF Size | 786 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_145040.2, NP_659477.2 |
RefSeq Size | 1039 |
RefSeq ORF | 786 |
Locus ID | 112464 |
Protein Families | Druggable Genome |
Gene Summary | The protein encoded by this gene was identified as a binding protein of the protein kinase C, delta (PRKCD). The expression of this gene in cultured cell lines is strongly induced by serum starvation. The expression of this protein was found to be down-regulated in various cancer cell lines, suggesting the possible tumor suppressor function of this protein. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC320781 | PRKCDBP (untagged)-Human protein kinase C, delta binding protein (PRKCDBP) |
USD 420.00 |
|
RC204254 | PRKCDBP (Myc-DDK-tagged)-Human protein kinase C, delta binding protein (PRKCDBP) |
USD 98.00 |
|
RG204254 | PRKCDBP (GFP-tagged) - Human protein kinase C, delta binding protein (PRKCDBP) |
USD 460.00 |
|
RC204254L1 | Lenti ORF clone of Human protein kinase C, delta binding protein (PRKCDBP), Myc-DDK-tagged |
USD 768.00 |
|
RC204254L2 | Lenti ORF clone of Human protein kinase C, delta binding protein (PRKCDBP), mGFP tagged |
USD 620.00 |
|
RC204254L3 | Lenti ORF clone of Human protein kinase C, delta binding protein (PRKCDBP), Myc-DDK-tagged |
USD 620.00 |
|
RC204254L4 | Lenti ORF clone of Human protein kinase C, delta binding protein (PRKCDBP), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review