DLGAP4 (NM_001042486) Human Untagged Clone

CAT#: SC311251

DLGAP4 (untagged)-Human discs, large (Drosophila) homolog-associated protein 4 (DLGAP4), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DLGAP4
• Synonyms: DAP-4; DAP4; DLP4; SAPAP-4; SAPAP4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001042486, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCCTCCCGACGGGACACAGACTCGGATACCCAGGATGCCAATGACTCAAGCTGTAAGTCATCTGAGA
  GGAGCCTCCCGGACTGTACCCCTCACCCCAACTCCATCAGCATCGATGCCGGTCCCCGGCAGGCCCCCAA
  GATTGCCCAGATCAAGCGCAACCTCTCCTATGGAGACAACAGCGACCCTGCCCTAGAGGCGTCCTCGCTG
  CCCCCACCCGACCCCTGGCTCGAGACCTCCTCCAGCTCCCCAGCAGAGCCGGCACAGCCAGGGGCCTGCC
  GCCGAGACGGCTACTGGTTCCTAAAGCTACTGCAGGCAGAAACAGAGCGGCTGGAAGGCTGGTGCTGCCA
  GATGGACAAGGAGACCAAAGAGAACAACCTCTCTGAAGAAGTCTTAGGAAAAGTCCTCAGTGCTGTGGGC
  AGTGCCCAGCTACTGATGTCCCAGAAATTCCAGCAGTTCCGGGGCCTCTGTGAGCAAAACTTGAACCCTG
  ATGCCAACCCACGCCCCACAGCCCAGGACCTGGCAGGGTTCTGGGACCTGCTACAGCTGTCCATCGAGGA
  TATCAGCATGAAGTTCGATGAACTCTACCACCTCAAGGCCAACAGCTGGCAGCTGGTGGAGACCCCCGAG
  AAGAGGAAGGAAGAGAAGAAACCACCCCCTCCGGTCCCAAAGAAGCCAGCCAAATCCAAGCCGGCAGTGA
  GCCGCGACAAGGCCTCAGACGCCAGCGACAAGCAGCGCCAGGAGGCCCGCAAGAGACTCCTGGCGGCCAA
  GCGGGCAGCTTCTGTGCGGCAGAACTCAGCCACCGAGAGCGCAGACAGCATCGAGATTTATGTCCCGGAG
  GCCCAGACCAGGCTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001042486
• ORF Size: 858 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001042486.3, NP_001035951.1
• RefSeq Size: 3044
• RefSeq ORF: 858
• Locus ID: 22839
• Gene Summary: The product of this gene is a membrane-associated guanylate kinase found at the postsynaptic density in neuronal cells. It is a signaling molecule that can interact with potassium channels and receptors, as well as other signaling molecules. The protein encoded by this gene can interact with PSD-95 through its guanylate kinase domain and may be involved in clustering PSD-95 in the postsynaptic density region. The encoded protein is one of at least four similar proteins that have been found. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (3) lacks several 5' exons but contains alternate 5' exon structure, and it thus differs in its 5' UTR and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (c) is shorter at the N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.