ASAHL (NAAA) (NM_001042402) Human Untagged Clone

CAT#: SC311253

NAAA (untagged)-Human N-acylethanolamine acid amidase (NAAA), transcript variant 2


  "NM_001042402" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "NAAA"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NAAA
Synonyms ASAHL; PLT
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001042402, the custom clone sequence may differ by one or more nucleotides


ATGCGGACCGCGGACCGGGAGGCGCGCCCGGGGCTTCCGTCCCTGCTGCTGCTGCTGCTGGCCGGGGCCG
GGCTGTCAGCCGCCTCGCCCCCAGCAGCGCCGCGCTTCAACGTGAGCCTGGACTCGGTCCCCGAGCTGCG
CTGGCTGCCCGTGCTGCGGCACTACGACTTGGACTTGGTGCGCGCCGCGATGGCGCAAGTCATCGGGGAC
AGAGTCCCCAAGTGGGTGCACGTGTTAATCGGAAAAGTGGTCCTGGAGCTGGAGCGCTTCCTGCCCCAGC
CCTTCACCGGCGAGATCCGCGGCATGTGTGACTTCATGAACCTCAGCCTGGCGGACTGCCTTCTGGTCAA
CCTGGCCTACGAGTCCTCCGTGTTCTGCACCAGTATTGTGGCTCAAGACTCCAGAGGCCACATTTACCAT
GGTCGGAATTTGGATTATCCTTTTGGGAATGTCTTACGCAAGCTGACAGTGGATGTGCAATTCTTAAAGA
ATGGGCAGATTGCATTCACAGGAACTACTTTTATTGGCTATGTAGGATTATGGACTGGCCAGAGCCCACA
CAAGTTTACAGTTTCTGGTGATGAACGAGATAAAGGCTGGTGGTGGGAGAATGCTATCGCTGCCCTGTTT
CGGAGACACATTCCCGTCAGCTGGCTGATCCGCGCTACCCTGAGTGAGTCGGAAAACTTCGAAGCAGCTG
TTGGCAAGTTGGCCAAGACTCCCCTTATTGCTGATGTTTATTACATTGTTGGTGGCACGTCCCCCCGGGA
GGGGGTGGTCATCACGAGGAACAGAGATGGCCCAGCAGACATTTGGCCTCTAGATCCTTTGAATGGAGCG
TGGTTCCGAGTTGAGACAAATTACGACCACTGGAAGCCAGCACCCAAGGAAGATGACCGGAGAACATCTG
CCATCAAGGCCCTTAATGCTACAGGACAAGCAAACCTCAGCCTGGAGGCACTTTTCCAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001042402
ORF Size 972 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001042402.1, NP_001035861.1
RefSeq Size 1738
RefSeq ORF 972
Locus ID 27163
Protein Families Transmembrane
Gene Summary This gene encodes an N-acylethanolamine-hydrolyzing enzyme which is highly similar to acid ceramidase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (2) is shorter at the C-terminus compared to isoform 1. Variants 2 and 3 both encode the same isoform (2).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.