MST4 (STK26) (NM_001042453) Human Untagged Clone
CAT#: SC311255
MST4 (untagged)-Human serine/threonine protein kinase MST4 (MST4), transcript variant 2
"NM_001042453" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | STK26 |
Synonyms | MASK; MST4 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001042453, the custom clone sequence may differ by one or more nucleotides
ATGGCCCACTCGCCGGTGGCTGTCCAAGTGCCTGGGATGCAGGGGTCTAAATTATGGATAATAATGGAAT ACCTGGGCGGTGGTTCAGCACTGGATCTTCTTCGAGCTGGTCCATTTGATGAGTTCCAGATTGCTACCAT GCTAAAGGAAATTTTAAAAGGTCTGGACTATCTGCATTCAGAAAAGAAAATTCACCGAGACATAAAAGCT GCCAATGTCTTGCTCTCAGAACAAGGAGATGTTAAACTTGCTGATTTTGGAGTTGCTGGTCAGCTGACAG ATACACAGATTAAAAGAAATACCTTTGTGGGAACTCCATTTTGGATGGCTCCTGAAGTTATTCAACAGTC AGCTTATGACTCAAAAGCTGACATTTGGTCATTGGGAATTACTGCTATTGAACTAGCCAAGGGAGAGCCA CCTAACTCCGATATGCATCCAATGAGAGTTCTGTTTCTTATTCCCAAAAACAATCCTCCAACTCTTGTTG GAGACTTTACTAAGTCTTTTAAGGAGTTTATTGATGCTTGCCTGAACAAAGATCCATCATTTCGTCCTAC AGCAAAAGAACTTCTGAAACACAAATTCATTGTAAAAAATTCAAAGAAGACTTCTTATCTGACTGAACTG ATAGATCGTTTTAAGAGATGGAAGGCAGAAGGACACAGTGATGATGAATCTGATTCCGAGGGCTCTGATT CGGAATCTACCAGCAGGGAAAACAATACTCATCCTGAATGGAGCTTTACCACCGTACGAAAGAAGCCTGA TCCAAAGAAAGTACAGAATGGGGCAGAGCAAGATCTTGTGCAAACCCTGAGTTGTTTGTCTATGATAATC ACACCTGCATTTGCTGAACTTAAACAGCAGGACGAGAATAACGCTAGCAGGAATCAGGCGATTGAAGAAC TCGAGAAAAGTATTGCTGTGGCTGAAGCCGCCTGTCCCGGCATCACAGATAAAATGGTGAAGAAACTAAT TGAAAAATTTCAAAAGTGTTCAGCAGACGAATCCCCCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001042453 |
ORF Size | 1020 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001042453.1, NP_001035918.1 |
RefSeq Size | 3121 |
RefSeq ORF | 1020 |
Locus ID | 51765 |
Protein Families | Druggable Genome, Protein Kinase |
Gene Summary | The product of this gene is a member of the GCK group III family of kinases, which are a subset of the Ste20-like kinases. The encoded protein contains an amino-terminal kinase domain, and a carboxy-terminal regulatory domain that mediates homodimerization. The protein kinase localizes to the Golgi apparatus and is specifically activated by binding to the Golgi matrix protein GM130. It is also cleaved by caspase-3 in vitro, and may function in the apoptotic pathway. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an alternate in-frame exon, compared to variant 1, resulting in a shorter isoform (2), compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212666 | MST4 (Myc-DDK-tagged)-Human serine/threonine protein kinase MST4 (MST4), transcript variant 2 |
USD 420.00 |
|
RG212666 | MST4 (GFP-tagged) - Human serine/threonine protein kinase MST4 (MST4), transcript variant 2 |
USD 460.00 |
|
RC212666L3 | Lenti ORF clone of Human serine/threonine protein kinase MST4 (MST4), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC212666L4 | Lenti ORF clone of Human serine/threonine protein kinase MST4 (MST4), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review