MST4 (STK26) (NM_001042453) Human Untagged Clone

CAT#: SC311255

MST4 (untagged)-Human serine/threonine protein kinase MST4 (MST4), transcript variant 2


  "NM_001042453" in other vectors (4)

Reconstitution Protocol

USD 580.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "STK26"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol STK26
Synonyms MASK; MST4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001042453, the custom clone sequence may differ by one or more nucleotides


ATGGCCCACTCGCCGGTGGCTGTCCAAGTGCCTGGGATGCAGGGGTCTAAATTATGGATAATAATGGAAT
ACCTGGGCGGTGGTTCAGCACTGGATCTTCTTCGAGCTGGTCCATTTGATGAGTTCCAGATTGCTACCAT
GCTAAAGGAAATTTTAAAAGGTCTGGACTATCTGCATTCAGAAAAGAAAATTCACCGAGACATAAAAGCT
GCCAATGTCTTGCTCTCAGAACAAGGAGATGTTAAACTTGCTGATTTTGGAGTTGCTGGTCAGCTGACAG
ATACACAGATTAAAAGAAATACCTTTGTGGGAACTCCATTTTGGATGGCTCCTGAAGTTATTCAACAGTC
AGCTTATGACTCAAAAGCTGACATTTGGTCATTGGGAATTACTGCTATTGAACTAGCCAAGGGAGAGCCA
CCTAACTCCGATATGCATCCAATGAGAGTTCTGTTTCTTATTCCCAAAAACAATCCTCCAACTCTTGTTG
GAGACTTTACTAAGTCTTTTAAGGAGTTTATTGATGCTTGCCTGAACAAAGATCCATCATTTCGTCCTAC
AGCAAAAGAACTTCTGAAACACAAATTCATTGTAAAAAATTCAAAGAAGACTTCTTATCTGACTGAACTG
ATAGATCGTTTTAAGAGATGGAAGGCAGAAGGACACAGTGATGATGAATCTGATTCCGAGGGCTCTGATT
CGGAATCTACCAGCAGGGAAAACAATACTCATCCTGAATGGAGCTTTACCACCGTACGAAAGAAGCCTGA
TCCAAAGAAAGTACAGAATGGGGCAGAGCAAGATCTTGTGCAAACCCTGAGTTGTTTGTCTATGATAATC
ACACCTGCATTTGCTGAACTTAAACAGCAGGACGAGAATAACGCTAGCAGGAATCAGGCGATTGAAGAAC
TCGAGAAAAGTATTGCTGTGGCTGAAGCCGCCTGTCCCGGCATCACAGATAAAATGGTGAAGAAACTAAT
TGAAAAATTTCAAAAGTGTTCAGCAGACGAATCCCCCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001042453
ORF Size 1020 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001042453.1, NP_001035918.1
RefSeq Size 3121
RefSeq ORF 1020
Locus ID 51765
Protein Families Druggable Genome, Protein Kinase
Gene Summary The product of this gene is a member of the GCK group III family of kinases, which are a subset of the Ste20-like kinases. The encoded protein contains an amino-terminal kinase domain, and a carboxy-terminal regulatory domain that mediates homodimerization. The protein kinase localizes to the Golgi apparatus and is specifically activated by binding to the Golgi matrix protein GM130. It is also cleaved by caspase-3 in vitro, and may function in the apoptotic pathway. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an alternate in-frame exon, compared to variant 1, resulting in a shorter isoform (2), compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.