TGIF (TGIF1) (NM_170695) Human Untagged Clone

CAT#: SC311264

TGIF1 (untagged)-Human TGFB-induced factor homeobox 1 (TGIF1), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TGIF1
• Synonyms: HPE4; TGIF
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_170695, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTTCTAGCGCAGAGCCGGGTGTCTGCCGGGGTGGGCTCCCCGCATTGTTCGGGCTCCGGCGGGGGCG
  GCTCTGATTCCTTTCCATGGCCCGCCTCCCACCCCGGGAATCCCCAGTGCTCCTTTTCCACGGCTTTTCT
  GGCGTCCCCCCGACTCTCCCGCGGCACTTTGGCCTACCTTCCCCCAGCGCCGTGGTCCTCCCTGGCGACC
  CCCTCTGCGCTCCTGGGGTCCTCCTGCGCCCCCCCTCCTCCACCGGCGCGCTGCCCACAGCCGCGTGCCC
  TCTCCCCGGAGCTGGGGACCAAGGCTGGGCCCCGCCGGCCGCATCGGTGGGAACTTCCGCGGTCCCCATC
  CCAGGGCGCACAGGGTCCAGCTCCTCGGCGCCGACTCCTGGAAACAATGAAAGGTATTGTTGCAGCATCT
  GGCAGTGAGACTGAGGATGAGGACAGCATGGACATTCCCTTGGACCTTTCTTCATCCGCTGGCTCAGGCA
  AGAGAAGGAGAAGGGGCAACCTACCCAAGGAGTCTGTGCAGATTCTTCGGGATTGGCTGTATGAGCACCG
  TTACAATGCCTATCCTTCAGAGCAAGAAAAAGCGTTGCTGTCCCAGCAAACACACCTGTCTACGCTACAG
  GTCTGTAACTGGTTCATCAACGCCCGCCGCAGGCTCCTCCCTGACATGCTGAGAAAGGATGGCAAAGATC
  CAAATCAGTTCACAATTTCCCGCCGTGGGGCCAAGATTTCTGAAACGAGCTCTGTGGAGTCCGTGATGGG
  CATCAAAAACTTCATGCCAGCTCTAGAGGAGACCCCATTTCATTCCTGTACAGCTGGGCCAAACCCAACC
  CTAGGGAGGCCACTGTCTCCTAAGCCGTCATCCCCGGGATCAGTTTTGGCTCGTCCATCAGTGATCTGCC
  ATACCACTGTGACTGCATTGAAAGATGTCCCTTTCTCTCTCTGCCAGTCGGTCGGTGTGGGACAAAACAC
  AGATATACAGCAGATAGCGGCCAAAAACTTCACAGACACCTCTCTCATGTACCCAGAGGACACTTGTAAA
  TCTGGACCAAGTACGAATACACAGAGTGGTCTTTTCAACACTCCTCCCCCTACTCCACCGGACCTCAACC
  AGGACTTCAGTGGATTTCAGCTTCTAGTGGATGTTGCACTCAAACGGGCTGCAGAGATGGAGCTTCAGGC
  AAAACTTACAGCTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_170695
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_170695.3, NP_733796.2
• RefSeq Size: 2264 bp
• RefSeq ORF: 1206 bp
• Locus ID: 7050
• Cytogenetics: 18p11.31
• Domains: homeobox
• Protein Families: Druggable Genome, Stem cell - Pluripotency, Stem cell relevant signaling - TGFb/BMP signaling pathway, Transcription Factors
• Gene Summary: 'The protein encoded by this gene is a member of the three-amino acid loop extension (TALE) superclass of atypical homeodomains. TALE homeobox proteins are highly conserved transcription regulators. This particular homeodomain binds to a previously characterized retinoid X receptor responsive element from the cellular retinol-binding protein II promoter. In addition to its role in inhibiting 9-cis-retinoic acid-dependent RXR alpha transcription activation of the retinoic acid responsive element, the protein is an active transcriptional co-repressor of SMAD2 and may participate in the transmission of nuclear signals during development and in the adult. Mutations in this gene are associated with holoprosencephaly type 4, which is a structural anomaly of the brain. Alternative splicing has been observed at this locus and multiple splice variants encoding distinct isoforms are described. [provided by RefSeq, Jul 2013]'
  Transcript Variant: This variant (1) is the longest transcript and encodes the longest isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.