FRMPD2 (NM_001042512) Human Untagged Clone

CAT#: SC311364

FRMPD2 (untagged)-Human FERM and PDZ domain containing 2 (FRMPD2), transcript variant 4


  "NM_001042512" in other vectors (5)

Reconstitution Protocol

USD 660.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "FRMPD2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FRMPD2
Synonyms PDZD5C; PDZK4; PDZK5C
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001042512, the custom clone sequence may differ by one or more nucleotides
ATGACATCTATCCCTTTCCCAGGTGACCGACTCCTGCAGGTGGATGGAGTGATTCTGTGC
GGCCTCACCCACAAGCAGGCTGTGCAGTGCCTGACGGGTCCTGGGCAGGTTGCAAGACTG
GTCTTAGAGAGAAGAGTCCCCAGGAGTACACAGCAGTGTCCTTCTGCTAATGACAGCATG
GGAGATGAACGCACGGCTGTTTCCTTGGTAACAGCCTTGCCTGGCAGGCCTTCGAGCTGT
GTCTCAGTGACAGATGGTCCTAAGTTTGAAGTCAAACTAAAAAAGAATGCCAATGGTTTG
GGATTCAGTTTCGTGCAGATGGAGAAAGAGAGCTGCAGCCATCTCAAAAGTGATCTTGTG
AGGATTAAGAGGCTCTTTCCGGGGCAGCCAGCTGAGGAGAATGGGGCCATTGCAGCTGGT
GACATTATCCTGGCCGTGAATGGAAGGTCCACGGAAGGCCTCATCTTCCAGGAGGTGCTG
CATTTACTGAGAGGGGCCCCACAGGAAGTCACGCTCCTCCTTTGCCGACCCCCTCCAGGT
GCGCTGCCTGAGCTGGAGCAGGAATGGCAGACACCTGAACTCTCAGCTGACAAAGAATTC
ACCAGGGCAACATGTACTGACTCATGTACCAGCCCCATCCTGGATCAAGAGGACAGCTGG
AGGGACAGTGCCTCCCCAGATGCAGGGGAAGGCCTGGGTCTCAGGCCAGAGTCTTCCCAA
AAGGCCATCAGAGAGGCACAATGGGGCCAAAACAGAGAGAGACCTTGGGCCAGTTCCTTG
ACACATTCTCCTGAGTCCCACCCTCATTTATGCAAACTTCACCAAGAAAGGGATGAATCA
ACATTGGCGACCTCTTTGGAAAAGGATGTGAGGCAAAACTGCTATTCAGTTTGTGATATC
ATGAGACTTGGAAGATATTCCTTCTCATCTCCTCTAACCAGACTTTCGACAGATATTTTC
TGA
Restriction Sites Please inquire     
ACCN NM_001042512
ORF Size 963 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001042512.1, NP_001035977.1
RefSeq Size 1892
RefSeq ORF 963
Locus ID 143162
Gene Summary This gene encodes a peripheral membrane protein and is located in a region of chromosome 10q that contains a segmental duplication. This copy of the gene is full-length and is in the telomeric duplicated region. Two other more centromerically proximal copies of the gene are partial and may represent pseudogenes. This full-length gene appears to function in the establishment and maintenance of cell polarization. The protein is recruited to cell-cell junctions in an E-cadherin-dependent manner, and is selectively localized at the basolateral membrane in polarized epithelial cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2009]
Transcript Variant: This variant (4) lacks several 5' exons but contains an alternate 5' exon, and it thus differs in the 5' UTR and 5' coding region, compared to variant 3. The encoded isoform (4) has a distinct and significantly shorter N-terminus, compared to isoform 3.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.