FRMPD2 (NM_001042512) Human Untagged Clone
CAT#: SC311364
FRMPD2 (untagged)-Human FERM and PDZ domain containing 2 (FRMPD2), transcript variant 4
"NM_001042512" in other vectors (5)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | FRMPD2 |
Synonyms | PDZD5C; PDZK4; PDZK5C |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001042512, the custom clone sequence may differ by one or more nucleotides
ATGACATCTATCCCTTTCCCAGGTGACCGACTCCTGCAGGTGGATGGAGTGATTCTGTGC GGCCTCACCCACAAGCAGGCTGTGCAGTGCCTGACGGGTCCTGGGCAGGTTGCAAGACTG GTCTTAGAGAGAAGAGTCCCCAGGAGTACACAGCAGTGTCCTTCTGCTAATGACAGCATG GGAGATGAACGCACGGCTGTTTCCTTGGTAACAGCCTTGCCTGGCAGGCCTTCGAGCTGT GTCTCAGTGACAGATGGTCCTAAGTTTGAAGTCAAACTAAAAAAGAATGCCAATGGTTTG GGATTCAGTTTCGTGCAGATGGAGAAAGAGAGCTGCAGCCATCTCAAAAGTGATCTTGTG AGGATTAAGAGGCTCTTTCCGGGGCAGCCAGCTGAGGAGAATGGGGCCATTGCAGCTGGT GACATTATCCTGGCCGTGAATGGAAGGTCCACGGAAGGCCTCATCTTCCAGGAGGTGCTG CATTTACTGAGAGGGGCCCCACAGGAAGTCACGCTCCTCCTTTGCCGACCCCCTCCAGGT GCGCTGCCTGAGCTGGAGCAGGAATGGCAGACACCTGAACTCTCAGCTGACAAAGAATTC ACCAGGGCAACATGTACTGACTCATGTACCAGCCCCATCCTGGATCAAGAGGACAGCTGG AGGGACAGTGCCTCCCCAGATGCAGGGGAAGGCCTGGGTCTCAGGCCAGAGTCTTCCCAA AAGGCCATCAGAGAGGCACAATGGGGCCAAAACAGAGAGAGACCTTGGGCCAGTTCCTTG ACACATTCTCCTGAGTCCCACCCTCATTTATGCAAACTTCACCAAGAAAGGGATGAATCA ACATTGGCGACCTCTTTGGAAAAGGATGTGAGGCAAAACTGCTATTCAGTTTGTGATATC ATGAGACTTGGAAGATATTCCTTCTCATCTCCTCTAACCAGACTTTCGACAGATATTTTC TGA |
Restriction Sites | Please inquire |
ACCN | NM_001042512 |
ORF Size | 963 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001042512.1, NP_001035977.1 |
RefSeq Size | 1892 |
RefSeq ORF | 963 |
Locus ID | 143162 |
Gene Summary | This gene encodes a peripheral membrane protein and is located in a region of chromosome 10q that contains a segmental duplication. This copy of the gene is full-length and is in the telomeric duplicated region. Two other more centromerically proximal copies of the gene are partial and may represent pseudogenes. This full-length gene appears to function in the establishment and maintenance of cell polarization. The protein is recruited to cell-cell junctions in an E-cadherin-dependent manner, and is selectively localized at the basolateral membrane in polarized epithelial cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2009] Transcript Variant: This variant (4) lacks several 5' exons but contains an alternate 5' exon, and it thus differs in the 5' UTR and 5' coding region, compared to variant 3. The encoded isoform (4) has a distinct and significantly shorter N-terminus, compared to isoform 3. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC329407 | FRMPD2 (untagged) - Homo sapiens FERM and PDZ domain containing 2 (FRMPD2), transcript variant 4 |
USD 330.00 |
|
RC217146 | Myc-DDK-tagged ORF clone of Homo sapiens FERM and PDZ domain containing 2 (FRMPD2), transcript variant 4 as transfection-ready DNA |
USD 420.00 |
|
RG217146 | FRMPD2 (GFP-tagged) - Human FERM and PDZ domain containing 2 (FRMPD2), transcript variant 4 |
USD 460.00 |
|
RC217146L3 | Lenti-ORF clone of Myc-DDK-tagged ORF clone of Homo sapiens FERM and PDZ domain containing 2 (FRMPD2), transcript variant 4 as transfection-ready DNA |
USD 620.00 |
|
RC217146L4 | Lenti-ORF clone of mGFP-tagged ORF clone of Homo sapiens FERM and PDZ domain containing 2 (FRMPD2), transcript variant 4 as transfection-ready DNA |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review