BIN1 (NM_139349) Human Untagged Clone

CAT#: SC311387

BIN1 (untagged)-Human bridging integrator 1 (BIN1), transcript variant 7


  "NM_139349" in other vectors (6)

Reconstitution Protocol

USD 790.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "BIN1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BIN1
Synonyms AMPH2; AMPHL; CNM2; SH3P9
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_139349, the custom clone sequence may differ by one or more nucleotides


ATGGCAGAGATGGGCAGTAAAGGGGTGACGGCGGGAAAGATCGCCAGCAACGTGCAGAAGAAGCTCACCC
GCGCGCAGGAGAAGGTTCTCCAGAAGCTGGGGAAGGCAGATGAGACCAAGGATGAGCAGTTTGAGCAGTG
CGTCCAGAATTTCAACAAGCAGCTGACGGAGGGCACCCGGCTGCAGAAGGATCTCCGGACCTACCTGGCC
TCCGTCAAAGCCATGCACGAGGCTTCCAAGAAGCTGAATGAGTGTCTGCAGGAGGTGTATGAGCCCGATT
GGCCCGGCAGGGATGAGGCAAACAAGATCGCAGAGAACAACGACCTGCTGTGGATGGATTACCACCAGAA
GCTGGTGGACCAGGCGCTGCTGACCATGGACACGTACCTGGGCCAGTTCCCCGACATCAAGTCACGCATT
GCCAAGCGGGGGCGCAAGCTGGTGGACTACGACAGTGCCCGGCACCACTACGAGTCCCTTCAAACTGCCA
AAAAGAAGGATGAAGCCAAAATTGCCAAGGCCGAGGAGGAGCTCATCAAAGCCCAGAAGGTGTTTGAGGA
GATGAATGTGGATCTGCAGGAGGAGCTGCCGTCCCTGTGGAACAGCCGCGTAGGTTTCTACGTCAACACG
TTCCAGAGCATCGCGGGCCTGGAGGAAAACTTCCACAAGGAGATGAGCAAGCTCAACCAGAACCTCAATG
ATGTGCTGGTCGGCCTGGAGAAGCAACACGGGAGCAACACCTTCACGGTCAAGGCCCAGCCCAGTGACAA
CGCGCCTGCAAAAGGGAACAAGAGCCCTTCGCCTCCAGATGGCTCCCCTGCCGCCACCCCCGAGATCAGA
GTCAACCACGAGCCAGAGCCGGCCGGCGGGGCCACGCCCGGGGCCACCCTCCCCAAGTCCCCATCTCAGC
CCACAGAGAGTCCAGCCGGCAGCCTGCCTTCCGGGGAGCCCAGCGCTGCCGAGGGCACCTTTGCTGTGTC
CTGGCCCAGCCAGACGGCCGAGCCGGGGCCTGCCCAACCAGCAGAGGCCTCGGAGGTGGCGGGTGGGACC
CAACCTGCGGCTGGAGCCCAGGAGCCAGGGGAGACGGCGGCAAGTGAAGCAGCCTCCAGCTCTCTTCCTG
CTGTCGTGGTGGAGACCTTCCCAGCAACTGTGAATGGCACCGTGGAGGGCGGCAGTGGGGCCGGGCGCTT
GGACCTGCCCCCAGGTTTCATGTTCAAGGTACAGGCCCAGCACGACTACACGGCCACTGACACAGACGAG
CTGCAGCTCAAGGCTGGTGATGTGGTGCTGGTGATCCCCTTCCAGAACCCTGAAGAGCAGGATGAAGGCT
GGCTCATGGGCGTGAAGGAGAGCGACTGGAACCAGCACAAGGAGCTGGAGAAGTGCCGTGGCGTCTTCCC
CGAGAACTTCACTGAGAGGGTCCCATGA


Restriction Sites SgfI-MluI     
ACCN NM_139349
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_139349.2, NP_647599.1
RefSeq Size 2332 bp
RefSeq ORF 1428 bp
Locus ID 274
Cytogenetics 2q14.3
Gene Summary 'This gene encodes several isoforms of a nucleocytoplasmic adaptor protein, one of which was initially identified as a MYC-interacting protein with features of a tumor suppressor. Isoforms that are expressed in the central nervous system may be involved in synaptic vesicle endocytosis and may interact with dynamin, synaptojanin, endophilin, and clathrin. Isoforms that are expressed in muscle and ubiquitously expressed isoforms localize to the cytoplasm and nucleus and activate a caspase-independent apoptotic process. Studies in mouse suggest that this gene plays an important role in cardiac muscle development. Alternate splicing of the gene results in several transcript variants encoding different isoforms. Aberrant splice variants expressed in tumor cell lines have also been described. [provided by RefSeq, Mar 2016]'
Transcript Variant: This variant (7) lacks three in-frame exons in the coding region, compared to variant 1. Isoform 7, also called IIc2 and S1/R3-c, is shorter than isoform 1 and binds dynamin and synaptojanin.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.