PSAP (NM_001042466) Human Untagged Clone
CAT#: SC311393
PSAP (untagged)-Human prosaposin (PSAP), transcript variant 3
"NM_001042466" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PSAP |
Synonyms | GLBA; SAP1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001042466, the custom clone sequence may differ by one or more nucleotides
ATGTACGCCCTCTTCCTCCTGGCCAGCCTCCTGGGCGCGGCTCTAGCCGGCCCGGTCCTTGGACTGAAAG AATGCACCAGGGGCTCGGCAGTGTGGTGCCAGAATGTGAAGACGGCGTCCGACTGCGGGGCAGTGAAGCA CTGCCTGCAGACCGTTTGGAACAAGCCAACAGTGAAATCCCTTCCCTGCGACATATGCAAAGACGTTGTC ACCGCAGCTGGTGATATGCTGAAGGACAATGCCACTGAGGAGGAGATCCTTGTTTACTTGGAGAAGACCT GTGACTGGCTTCCGAAACCGAACATGTCTGCTTCATGCAAGGAGATAGTGGACTCCTACCTCCCTGTCAT CCTGGACATCATTAAAGGAGAAATGAGCCGTCCTGGGGAGGTGTGCTCTGCTCTCAACCTCTGCGAGTCT CTCCAGAAGCACCTAGCAGAGCTGAATCACCAGAAGCAGCTGGAGTCCAATAAGATCCCAGAGCTGGACA TGACTGAGGTGGTGGCCCCCTTCATGGCCAACATCCCTCTCCTCCTCTACCCTCAGGACGGCCCCCGCAG CAAGCCCCAGCCAAAGGATAATGGGGACGTTTGCCAGGACTGCATTCAGATGGTGACTGACATCCAGACT GCTGTACGGACCAACTCCACCTTTGTCCAGGCCTTGGTGGAACATGTCAAGGAGGAGTGTGACCGCCTGG GCCCTGGCATGGCCGACATATGCAAGAACTATATCAGCCAGTATTCTGAAATTGCTATCCAGATGATGAT GCACATGGATCAGCAACCCAAGGAGATCTGTGCGCTGGTTGGGTTCTGTGATGAGGTGAAAGAGATGCCC ATGCAGACTCTGGTCCCCGCCAAAGTGGCCTCCAAGAATGTCATCCCTGCCCTGGAACTGGTGGAGCCCA TTAAGAAGCACGAGGTCCCAGCAAAGTCTGATGTTTACTGTGAGGTGTGTGAATTCCTGGTGAAGGAGGT GACCAAGCTGATTGACAACAACAAGACTGAGAAAGAAATACTCGACGCTTTTGACAAAATGTGCTCGAAG CTGCCGAAGTCCCTGTCGGAAGAGTGCCAGGAGGTGGTGGACACGTACGGCAGCTCCATCCTGTCCATCC TGCTGGAGGAGGTCAGCCCTGAGCTGGTGTGCAGCATGCTGCACCTCTGCTCTGGCACGCGGCTGCCTGC ACTGACCGTTCACGTGACTCAGCCAAAGGACGGTGGCTTCTGCGAAGTGTGCAAGAAGCTGGTGGGTTAT TTGGATCGCAACCTGGAGAAAAACAGCACCAAGCAGGAGATCCTGGCTGCTCTTGAGAAAGGCTGCAGCT TCCTGCCAGACCCTTACCAGAAGCAGTGTGATCAGTTTGTGGCAGAGTACGAGCCCGTGCTGATCGAGAT CCTGGTGGAGGTGATGGATCCTTCCTTCGTGTGCTTGAAAATTGGAGCCTGCCCCTCGGCCCATAAGCCC TTGTTGGGAACTGAGAAGTGTATATGGGGCCCAAGCTACTGGTGCCAGAACACAGAGACAGCAGCCCAGT GCAATGCTGTCGAGCATTGCAAACGCCATGTGTGGAACTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001042466 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001042466.2, NP_001035931.1 |
RefSeq Size | 2912 bp |
RefSeq ORF | 1581 bp |
Locus ID | 5660 |
Cytogenetics | 10q22.1 |
Protein Families | Druggable Genome |
Protein Pathways | Lysosome |
Gene Summary | 'This gene encodes a highly conserved preproprotein that is proteolytically processed to generate four main cleavage products including saposins A, B, C, and D. Each domain of the precursor protein is approximately 80 amino acid residues long with nearly identical placement of cysteine residues and glycosylation sites. Saposins A-D localize primarily to the lysosomal compartment where they facilitate the catabolism of glycosphingolipids with short oligosaccharide groups. The precursor protein exists both as a secretory protein and as an integral membrane protein and has neurotrophic activities. Mutations in this gene have been associated with Gaucher disease and metachromatic leukodystrophy. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]' Transcript Variant: This variant (3) uses an alternate in-frame splice site in the coding region, compared to variant 2, resulting in a shorter protein (isoform c), compared to isoform b. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213049 | PSAP (Myc-DDK-tagged)-Human prosaposin (PSAP), transcript variant 3 |
USD 420.00 |
|
RG213049 | PSAP (GFP-tagged) - Human prosaposin (PSAP), transcript variant 3 |
USD 460.00 |
|
RC213049L3 | Lenti ORF clone of Human prosaposin (PSAP), transcript variant 3, Myc-DDK-tagged |
USD 620.00 |
|
RC213049L4 | Lenti ORF clone of Human prosaposin (PSAP), transcript variant 3, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review