TNNT3 (NM_001042781) Human Untagged Clone

CAT#: SC311462

TNNT3 (untagged)-Human troponin T type 3 (skeletal, fast) (TNNT3), transcript variant 2


  "NM_001042781" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "TNNT3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TNNT3
Synonyms beta-TnTF; DA2B2; TNTF
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001042781, the custom clone sequence may differ by one or more nucleotides
ATGTCTGACGAGGAAGTTGAACAGGTGGAGGAGCAGTACGAAGAAGAAGAGGAAGCCCAG
GAGGAAGCTGCAGAAGTCCATGAGGAAGTTCATGAACCAGAGGAGAAACCGAGACCCAAA
CTCACTGCTCCTAAGATCCCAGAAGGGGAGAAAGTGGACTTCGATGACATCCAGAAGAAG
CGTCAGAACAAAGACCTAATGGAGCTCCAGGCCCTCATCGACAGCCACTTTGAAGCCCGG
AAGAAGGAGGAGGAGGAGCTGGTCGCTCTCAAAGAGAGAATCGAGAAGCGCCGTGCAGAG
AGAGCGGAGCAGCAGAGGATTCGTGCAGAGAAGGAGAGGGAGCGCCAGAACAGACTGGCG
GAGGAAAAGGCCAGAAGGGAGGAGGAGGATGCCAAGAGGAGGGCAGAGGACGACCTGAAG
AAGAAGAAAGCTCTGTCTTCCATGGGAGCCAACTACAGCAGCTACCTGGCCAAGGCTGAC
CAGAAGAGAGGCAAGAAGCAGACAGCCCGGGAAATGAAGAAGAAGATTCTGGCTGAGAGA
CGCAAGCCGCTCAACATCGATCACCTTGGTGAAGACAAACTGAGGGACAAGGCCAAGGAG
CTCTGGGAGACCCTGCACCAGCTGGAGATTGACAAGTTCGAGTTTGGGGAGAAGCTGAAA
CGCCAGAAATATGACATCACCACGCTCAGGAGCCGCATTGACCAGGCCCAGAAGCACAGC
AAGAAGGCTGGGACCCCAGCCAAGGGCAAAGTCGGCGGGCGCTGGAAGTAG
Restriction Sites Please inquire     
ACCN NM_001042781
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001042781.1, NP_001036246.1
RefSeq Size 1005 bp
RefSeq ORF 771 bp
Locus ID 7140
Cytogenetics 11p15.5
Gene Summary 'The binding of Ca(2+) to the trimeric troponin complex initiates the process of muscle contraction. Increased Ca(2+) concentrations produce a conformational change in the troponin complex that is transmitted to tropomyosin dimers situated along actin filaments. The altered conformation permits increased interaction between a myosin head and an actin filament which, ultimately, produces a muscle contraction. The troponin complex has protein subunits C, I, and T. Subunit C binds Ca(2+) and subunit I binds to actin and inhibits actin-myosin interaction. Subunit T binds the troponin complex to the tropomyosin complex and is also required for Ca(2+)-mediated activation of actomyosin ATPase activity. There are 3 different troponin T genes that encode tissue-specific isoforms of subunit T for fast skeletal-, slow skeletal-, and cardiac-muscle. This gene encodes fast skeletal troponin T protein; also known as troponin T type 3. Alternative splicing results in multiple transcript variants encoding additional distinct troponin T type 3 isoforms. A developmentally regulated switch between fetal/neonatal and adult troponin T type 3 isoforms occurs. Additional splice variants have been described but their biological validity has not been established. Mutations in this gene may cause distal arthrogryposis multiplex congenita type 2B (DA2B). [provided by RefSeq, Oct 2009]'
Transcript Variant: This variant (2) contains two different internal coding exons and lacks another coding exon compared to transcript variant 1. However, it maintains the reading frame, and encodes a slightly shorter isoform (2) with a different internal segment compared to isoform 1. Variants 2 and 7 both encode the same isoform (2).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.