LCK (NM_001042771) Human Untagged Clone

CAT#: SC311484

LCK (untagged)-Human lymphocyte-specific protein tyrosine kinase (LCK), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: LCK
• Synonyms: IMD22; LSK; p56lck; pp58lck; YT16
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001042771, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGCTGTGGCTGCAGCTCACACCCGGAAGATGACTGGATGGAAAACATCGATGTGTGTGAGAACTGCC
  ATTATCCCATAGTCCCACTGGATGGCAAGGGCACGCTGCTCATCCGAAATGGCTCTGAGGTGCGGGACCC
  ACTGGTTACCTACGAAGGCTCCAATCCGCCGGCTTCCCCACTGCAAGACAACCTGGTTATCGCTCTGCAC
  AGCTATGAGCCCTCTCACGACGGAGATCTGGGCTTTGAGAAGGGGGAACAGCTCCGCATCCTGGAGCAGA
  GCGGCGAGTGGTGGAAGGCGCAGTCCCTGACCACGGGCCAGGAAGGCTTCATCCCCTTCAATTTTGTGGC
  CAAAGCGAACAGCCTGGAGCCCGAACCCTGGTTCTTCAAGAACCTGAGCCGCAAGGACGCGGAGCGGCAG
  CTCCTGGCGCCCGGGAACACTCACGGCTCCTTCCTCATCCGGGAGAGCGAGAGCACCGCGGGATCGTTTT
  CACTGTCGGTCCGGGACTTCGACCAGAACCAGGGAGAGGTGGTGAAACATTACAAGATCCGTAATCTGGA
  CAACGGTGGCTTCTACATCTCCCCTCGAATCACTTTTCCCGGCCTGCATGAACTGGTCCGCCATTACACC
  AATGCTTCAGATGGGCTGTGCACACGGTTGAGCCGCCCCTGCCAGACCCAGAAGCCCCAGAAGCCGTGGT
  GGGAGGACGAGTGGGAGGTTCCCAGGGAGACGCTGAAGCTGGTGGAGCGGCTGGGGGCTGGACAGTTCGG
  GGAGGTGTGGATGGGGTACTACAACGGGCACACGAAGGTGGCGGTGAAGAGCCTGAAGCAGGGCAGCATG
  TCCCCGGACGCCTTCCTGGCCGAGGCCAACCTCATGAAGCAGCTGCAACACCAGCGGCTGGTTCGGCTCT
  ACGCTGTGGTCACCCAGGAGCCCATCTACATCATCACTGAATACATGGAGAATGGGAGTCTAGTGGATTT
  TCTCAAGACCCCTTCAGGCATCAAGTTGACCATCAACAAACTCCTGGACATGGCAGCCCAAATTGCAGAA
  GGCATGGCATTCATTGAAGAGCGGAATTATATTCATCGTGACCTTCGGGCTGCCAACATTCTGGTGTCTG
  ACACCCTGAGCTGCAAGATTGCAGACTTTGGCCTAGCACGCCTCATTGAGGACAACGAGTACACAGCCAG
  GGAGGGGGCCAAGTTTCCCATTAAGTGGACAGCGCCAGAAGCCATTAACTACGGGACATTCACCATCAAG
  TCAGATGTGTGGTCTTTTGGGATCCTGCTGACGGAAATTGTCACCCACGGCCGCATCCCTTACCCAGGGA
  TGACCAACCCGGAGGTGATTCAGAACCTGGAGCGAGGCTACCGCATGGTGCGCCCTGACAACTGTCCAGA
  GGAGCTGTACCAACTCATGAGGCTGTGCTGGAAGGAGCGCCCAGAGGACCGGCCCACCTTTGACTACCTG
  CGCAGTGTGCTGGAGGACTTCTTCACGGCCACAGAGGGCCAGTACCAGCCTCAGCCTTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001042771
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001042771.2, NP_001036236.1
• RefSeq Size: 2102 bp
• RefSeq ORF: 1530 bp
• Locus ID: 3932
• Cytogenetics: 1p35.2
• Protein Families: Druggable Genome, Protein Kinase, Stem cell - Pluripotency
• Protein Pathways: Natural killer cell mediated cytotoxicity, Primary immunodeficiency, T cell receptor signaling pathway
• Gene Summary: 'This gene is a member of the Src family of protein tyrosine kinases (PTKs). The encoded protein is a key signaling molecule in the selection and maturation of developing T-cells. It contains N-terminal sites for myristylation and palmitylation, a PTK domain, and SH2 and SH3 domains which are involved in mediating protein-protein interactions with phosphotyrosine-containing and proline-rich motifs, respectively. The protein localizes to the plasma membrane and pericentrosomal vesicles, and binds to cell surface receptors, including CD4 and CD8, and other signaling molecules. Multiple alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Aug 2016]'
  Transcript Variant: This variant (1) is transcribed from the proximal type I promoter. Variants 1 and 2 encode the same isoform (a).