FGF1 (NM_033136) Human Untagged Clone
CAT#: SC311522
FGF1 (untagged)-Human fibroblast growth factor 1 (acidic) (FGF1), transcript variant 2
"NM_033136" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | FGF1 |
Synonyms | AFGF; ECGF; ECGF-beta; ECGFA; ECGFB; FGF-1; FGF-alpha; FGFA; GLIO703; HBGF-1; HBGF1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_033136, the custom clone sequence may differ by one or more nucleotides
ATGGCTGAAGGGGAAATCACCACCTTCACAGCCCTGACCGAGAAGTTTAATCTGCCTCCA GGGAATTACAAGAAGCCCAAACTCCTCTACTGTAGCAACGGGGGCCACTTCCTGAGGATC CTTCCGGATGGCACAGTGGATGGGACAAGGGACAGGAGCGACCAGCACACAGACACCAAA |
Restriction Sites | Please inquire |
ACCN | NM_033136 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_033136.1, NP_149127.1 |
RefSeq Size | 2253 bp |
RefSeq ORF | 183 bp |
Locus ID | 2246 |
Cytogenetics | 5q31.3 |
Domains | FGF |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | MAPK signaling pathway, Melanoma, Pathways in cancer, Regulation of actin cytoskeleton |
Gene Summary | 'The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein functions as a modifier of endothelial cell migration and proliferation, as well as an angiogenic factor. It acts as a mitogen for a variety of mesoderm- and neuroectoderm-derived cells in vitro, thus is thought to be involved in organogenesis. Multiple alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Jan 2009]' Transcript Variant: This variant (2) lacks an exon in the coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1. Variants 2 and 23-27 encode the same isoform (2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219380 | FGF1 (Myc-DDK-tagged)-Human fibroblast growth factor 1 (acidic) (FGF1), transcript variant 2 |
USD 420.00 |
|
RG219380 | FGF1 (GFP-tagged) - Human fibroblast growth factor 1 (acidic) (FGF1), transcript variant 2 |
USD 460.00 |
|
RC219380L3 | Lenti-ORF clone of FGF1 (Myc-DDK-tagged)-Human fibroblast growth factor 1 (acidic) (FGF1), transcript variant 2 |
USD 620.00 |
|
RC219380L4 | Lenti-ORF clone of FGF1 (mGFP-tagged)-Human fibroblast growth factor 1 (acidic) (FGF1), transcript variant 2 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review