OSBPL11 (AF318344) Human Untagged Clone

CAT#: SC311633

(untagged)-Human pp14733 mRNA, complete cds

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: OSBPL11
• Synonyms: ORP-11|ORP11|OSBP12|TCCCIA00292
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for AF318344, the custom clone sequence may differ by one or more nucleotides
  ATGAAGGTTAGGAAAAATAATGATGCTTATTTACTAGACAAGAACAAAATTAATATGGAT
  TGTTTCATTAGCTGTTTCTTTAAAAAGATGTTAACCACCCTCATGTTTTCACATTCAGGT
  ATCCTTAGTCTGTTGGAGCATGGAGAAGAGTACACATTTTCTCTACCCTGTGCATATGCT
  CGGTCAATTTTGACTGTTCCTTGGGTAGAACTGGGTGGCAAAGTCAGTGTCAACTGTGCA
  AAAACTGGATATTCAGCCAGCATCACTTTTCATACCAAGCCATTTTATGGTGGCAAACTG
  CATCGG
  
• Restriction Sites: Please inquire
• ACCN: AF318344
• ORF Size: 309 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: AF318344.1, AAL55851.1
• RefSeq Size: 2638
• RefSeq ORF: 309
• Locus ID: 114885
• Gene Summary: This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Like most members, the encoded protein contains an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. [provided by RefSeq, Jul 2008]