SMRC2 (SMARCC2) (AL833124) Human Untagged Clone

CAT#: SC311683

(untagged)-Human mRNA, cDNA DKFZp313D0632 (from clone DKFZp313D0632)


Reconstitution Protocol

USD 960.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SMARCC2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SMARCC2
Synonyms BAF170|CRACC2|Rsc8
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for AL833124, the custom clone sequence may differ by one or more nucleotides
ATGGCGGTGCGGAAGAAGGACGGCGGCCCCAACGTGAAGTACTACGAGGCCGCGGACACC
GTGACCCAGTTCGACAACGTGCGGCTGTGGCTCGGCAAGAACTACAAGAAGTATATACAA
GCTGAACCACCCACCAACAAGTCCCTGTCTAGCCTGGTTGTACAGTTGCTACAATTTCAG
GAAGAAGTTTTTGGCAAACATGTCAGCAATGCACCGCTCACTAAACTGCCGGTGAGTGCA
GAAGTAGCAGGGAGGGTGGGGGGTGGTGGTGGTGAATCCTTCAAACTGAAGAGTTGTATT
TTAAAAAAAGATTTG
Restriction Sites Please inquire     
ACCN AL833124
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq AL833124.1, CAH56218.1
RefSeq Size 3250 bp
RefSeq ORF 318 bp
Locus ID 6601
Cytogenetics 12q13.2
Protein Families Transcription Factors
Gene Summary 'The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and contains a predicted leucine zipper motif typical of many transcription factors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]'

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.