NT5DC1 (AF245044) Human Untagged Clone

CAT#: SC311717

(untagged)-Human HT023 mRNA, complete cds

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NT5DC1
• Synonyms: C6orf200|LP2642|NT5C2L1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for AF245044, the custom clone sequence may differ by one or more nucleotides
  ATGGGTTTTACAGGCATGCTACAATCCAGGACTGTGGTGTTCTATGTGCCGTGTATGGTC
  ATATTAGTAGCTATTTGTTGCAAGATACTTGAAGCCAAATGTTTGCAGTATAGGTTCCTG
  GCTACTGTTTATGCTGTGATTTCACTCTGTCTATCATGGGCAGTATTAGAAAACACACTG
  GTTTTCACTATCTGGTTTACAAACACTATCATTATTTTACCTGGATTGAAGTGCAGAATT
  TGGCATATCGATGCATGCAATGGAAAGAAAAAAAATTTGTTAAAATTTGTAAATGTTCAG
  CTAAATCTCAGATATACTGTGGGA
  
• Restriction Sites: Please inquire
• ACCN: AF245044
• ORF Size: 1512 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: AF245044.1, AAG44481.1
• RefSeq Size: 1512
• RefSeq ORF: 1512
• Locus ID: 221294
• Gene Summary: While the exact function of the protein encoded by this gene is not known, it belongs to the 5'(3')-deoxyribonucleotidase family. [provided by RefSeq, May 2010]