ANKH (AF289590) Human Untagged Clone

CAT#: SC311820

(untagged)-Human clone pp7583 unknown mRNA

SDS

Reconstitution Protocol

USD 960.00

3 Weeks*

Size
    • 10 ug
Bulk Requests & Clone Modifications

Product Images

Other products for "ANKH"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ANKH
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for AF289590, the custom clone sequence may differ by one or more nucleotides
ATGCTAAACTGGTTGGCCCAAATCCAACAGATTGCAAAGAGTGGCAGGGCCTGGCAGCTG
TCTGGAAGCCCTTCATCTTACAGACAAGGAAGTGGTGTCAAATGGACAGTAAAGGTGAAT
CACATACTCAGCTATAGCCTGCTCCCAGCTGGGGCACTCCAGGCCCCTCCTCTGGTCACT
ACTGTAGAAATTAACTGCATGTGTCTCAATCTGCGAGTGCAGCTGCTTCTAGATGGTGGC
ACCTTCCAGAGCTTGGTTCGCCCTGTGTCTACCCAACAAGTACAGATGCCATCCCGGTGC
TGTGATCTTCCAGCCATTTCTCCATTTCTGTCACAGCCCAGAAAG
Restriction Sites Please inquire     
ACCN AF289590
ORF Size 348 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq AF289590.1, AAL55774.1
RefSeq Size 2639
RefSeq ORF 348
Locus ID 56172
Protein Families Druggable Genome, Transmembrane
Gene Summary This gene encodes a multipass transmembrane protein that is expressed in joints and other tissues and controls pyrophosphate levels in cultured cells. Progressive ankylosis-mediated control of pyrophosphate levels has been suggested as a possible mechanism regulating tissue calcification and susceptibility to arthritis in higher animals. Mutations in this gene have been associated with autosomal dominant craniometaphyseal dysplasia. [provided by RefSeq, Jul 2008]

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.