PDS5B (AK026889) Human Untagged Clone
Product Images
Other products for "PDS5B"
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | PDS5B |
| Synonyms | APRIN|AS3|CG008 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for AK026889, the custom clone sequence may differ by one or more nucleotides
ATGGATGACTTGACTAAGTTGGTACAGGAACAGAAACCTAAAGGCAGTCAGCGAAGTCGG AAAAGAGGCCATACGGCTTCAGAATCTGATGAACAGCAGTGGCCTGAGGAAAAGAGGCTC AAAGAAGATATATTAGAAAATGAAGATGAACAGAATAGTCCGCCAAAAAAGGGTAAAAGA GGCCGACCACCAAAACCTCTTGGTGGAGGTACACCAAAAGAAGAGCCAACAATGAAAACT TCTAAAAAAGGAAGCAAAAAAAAATCTGGACCTCCAGCACCAGAGGAGGAGGAAGAAGAA GAAAGACAAAGTGGAAATACGGAACAGAAGTCCAAAAGCAAACAGCACCGAGTGTCAAGG AGAGCACAGCAGAGG |
| Restriction Sites | Please inquire |
| ACCN | AK026889 |
| ORF Size | 2079 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Reference Data | |
| RefSeq | AK026889.1, BAB15584.1 |
| RefSeq Size | 2079 |
| RefSeq ORF | 2079 |
| Locus ID | 23047 |
| Gene Summary | This gene encodes a protein that interacts with the conserved protein complex termed cohesin. The cohesin complex holds together sister chromatids and facilitates accurate chromosome segregation during mitosis and meiosis. This protein is also a negative regulator of cell proliferation and may be a tumor-suppressor gene. [provided by RefSeq, Jul 2015] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Germany
Japan
United Kingdom
China