PDS5B (AK026889) Human Untagged Clone

CAT#: SC311932

(untagged)-Human cDNA: FLJ23236 fis, clone COL00725


Reconstitution Protocol

USD 960.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PDS5B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PDS5B
Synonyms APRIN|AS3|CG008
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for AK026889, the custom clone sequence may differ by one or more nucleotides
ATGGATGACTTGACTAAGTTGGTACAGGAACAGAAACCTAAAGGCAGTCAGCGAAGTCGG
AAAAGAGGCCATACGGCTTCAGAATCTGATGAACAGCAGTGGCCTGAGGAAAAGAGGCTC
AAAGAAGATATATTAGAAAATGAAGATGAACAGAATAGTCCGCCAAAAAAGGGTAAAAGA
GGCCGACCACCAAAACCTCTTGGTGGAGGTACACCAAAAGAAGAGCCAACAATGAAAACT
TCTAAAAAAGGAAGCAAAAAAAAATCTGGACCTCCAGCACCAGAGGAGGAGGAAGAAGAA
GAAAGACAAAGTGGAAATACGGAACAGAAGTCCAAAAGCAAACAGCACCGAGTGTCAAGG
AGAGCACAGCAGAGG
Restriction Sites Please inquire     
ACCN AK026889
ORF Size 2079 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq AK026889.1, BAB15584.1
RefSeq Size 2079
RefSeq ORF 2079
Locus ID 23047
Gene Summary This gene encodes a protein that interacts with the conserved protein complex termed cohesin. The cohesin complex holds together sister chromatids and facilitates accurate chromosome segregation during mitosis and meiosis. This protein is also a negative regulator of cell proliferation and may be a tumor-suppressor gene. [provided by RefSeq, Jul 2015]

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.