C5orf56 (AK096941) Human Untagged Clone

CAT#: SC311942

(untagged)-Human cDNA FLJ39622 fis, clone SMINT2001199

SDS

Reconstitution Protocol

USD 960.00

3 Weeks*

Size
    • 10 ug
Bulk Requests & Clone Modifications

Product Images

Other products for "C5orf56"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol C5orf56
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for AK096941, the custom clone sequence may differ by one or more nucleotides
ATGGACTCCCTGGCTGCTGGAGAGTTGAATGCCAGCCACCAGCCATGGGTGCCAGAGTTT
GTAGCCTATTGGAGGAAAACACACCAAGGGAATCTTCAAACTCTTCTTCTCCACTGGCTC
CTGCTGTGCTCCTGTCTCCATCACCTGTATAATGCTTCCTGCCATCCTACCTTCCCCGTG
GAGTACAGCCATGCTGTCTGCTGCTTACAGCCAAGATTCTGGAAAGAAATGTCTCCTTTT
TCCTCGTCATCAACCACTCATTTATTCAGCAAGTGTTTCTTTTACACTTGCCTGTGCTGG
GCATGGCAGCAATGCAGCAGTGAACAAAACCACCAGCCCTGCTCTCATGCAGCTTATAAT
CAAGTAGAGAGACAGACA
Restriction Sites Please inquire     
ACCN AK096941
ORF Size 2025 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq AK096941.1, BAC04907.1
RefSeq Size 2025
RefSeq ORF 2025
Locus ID 441108

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.