TMEM18 (BC032379) Human Untagged Clone

CAT#: SC311955

TMEM18 (untagged)-Homo sapiens, Similar to hypothetical protein DKFZp434C1714, clone MGC:40460 IMAGE:5109444, complete cds


Reconstitution Protocol

USD 960.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "TMEM18"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TMEM18
Synonyms DKFZp434C1714; transmembrane protein 18
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for BC032379, the custom clone sequence may differ by one or more nucleotides
ATGCTCTCTGGATACTTGCAGACGGACTGGACTGAGCCCTGGCTCATGGGGCTGGCCACC
TTCCACGCGCTCTGCGTGCTCCTCACCTGCTTGTCCTCCCGAAGCTACAGACTACAGATC
GGGCACTTTCTGTGTCTAGTCATCTTAGTCTACTGTGCTGAATACATCAATGAGGCGGCT
GCGATGAACTGGAGATTATTTTCGAAATACCAGTATTTCGACTCCAGGGGGATGTTCATT
TCTATAGTATTTTCAGCCCCACTGCTGGTGAATGCCATGATCATTGTGGTTATGTGGGTA
TGGAAGACTTTGAATGTGATGACTGACCTGAAGAATGCACAAGAGAGAAGAAAGGAAAAG
AAAAGGAGAAGGAAAGAAGAC
Restriction Sites Please inquire     
ACCN BC032379
ORF Size 384 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq BC032379.1, AAH32379.1
RefSeq Size 2398
RefSeq ORF 384
Locus ID 129787
Protein Families Transmembrane

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.