SHMT2 (AK055053) Human Untagged Clone

CAT#: SC312033

(untagged)-Human cDNA FLJ30491 fis, clone BRAWH2000177, moderately similar to SERINE HYDROXYMETHYLTRANSFERASE, MITOCHONDRIAL PRECURSOR (EC 2.1.2.1)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SHMT2
• Synonyms: GLYA|HEL-S-51e|SHMT
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for AK055053, the custom clone sequence may differ by one or more nucleotides
  ATGCTGTACTTCTCTTTGTTTTGGGCGGCTCGGCCTCTGCAGAGATGTGGGCAGCTGGTC
  AGGATGGCCATTCGGGCTCAGCACAGCAACGCAGCCCAGACTCAGACTGGGGAAGCAAAC
  AGGGGCTGGACAGGCCAGGAGAGCCTGTCGGACAGTGATCCTGAGATGTGGGAGTTGCTG
  CAGAGGGAGAAGGACAGGCAGTGTCGTGGCCTGGAGCTCATTGCCTCAGAGGTGGGACCT
  GGGGAGATGGGCAGGGGTTGGGCCACCATGGGTACAGGAAGTAACAAAGTTATCTTAACT
  GATATTTCTCCAAAACCCCCTTTCACACTCAGGACCTTTCTTTGGGCTTTATCTTCCTTT
  CTTATCTCCCTCAAGCAAAGGCAGTGCAAGTCCAGTTTATGGGGT
  
• Restriction Sites: Please inquire
• ACCN: AK055053
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: AK055053.1
• RefSeq Size: 3412 bp
• RefSeq ORF: 3412 bp
• Locus ID: 6472
• Cytogenetics: 12q13.3
• Protein Pathways: Cyanoamino acid metabolism, Glycine, serine and threonine metabolism, Metabolic pathways, Methane metabolism, One carbon pool by folate
• Gene Summary: 'This gene encodes the mitochondrial form of a pyridoxal phosphate-dependent enzyme that catalyzes the reversible reaction of serine and tetrahydrofolate to glycine and 5,10-methylene tetrahydrofolate. The encoded product is primarily responsible for glycine synthesis. The activity of the encoded protein has been suggested to be the primary source of intracellular glycine. The gene which encodes the cytosolic form of this enzyme is located on chromosome 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]'