Hsp75 (TRAP1) (AK095412) Human Untagged Clone

CAT#: SC312046

(untagged)-Human cDNA FLJ38093 fis, clone CTONG2027361

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TRAP1
• Synonyms: DNL1|DRNI
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for AK095412, the custom clone sequence may differ by one or more nucleotides
  ATGGTAAGGGGCTGGCCAGGTTCCATTTCACATGGGTGCAACCTAAACTGCATACAGCTC
  CTTATAGTTACCCACATGTCCACAGGCCTCACGCACTTTTCTTCTGTGTCACATTCCACA
  ACAAAAGAACACCACACACAGGATTCTGGGGAATCCCACAGGCTGGAAGAGCCAGGAGCG
  TGGCCTCACCTGGGGTTGATCTCCAGCGTGGGCTGCAGGAGCTGTGCGCGCTCCTCCTGG
  GTCTTGGCCAGCTGCTGCATGCGCAGGAAGTGGCGGGCAGCCCCCATCTCCAGCACGGTG
  ACCATGGCAGGGTGGGTGTCCAGTCGGAGGGTCACCTGTGAGCAAAGCCCGGGGTTGAGG
  GTGATAGAGGTTCCCAATGTGAGAGGGCTGGCAGGATCTTACCAGGGG
  
• Restriction Sites: Please inquire
• ACCN: AK095412
• ORF Size: 2777 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: AK095412.1
• RefSeq Size: 2777
• RefSeq ORF: 2777
• Locus ID: 10131
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a mitochondrial chaperone protein that is member of the heat shock protein 90 (HSP90) family. The encoded protein has ATPase activity and interacts with tumor necrosis factor type I. This protein may function in regulating cellular stress responses. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]