ATP dependent metalloprotease YME1L1 (YME1L1) (BC019602) Human Untagged Clone

CAT#: SC312048

YME1L1 (untagged)-Homo sapiens, clone IMAGE:3865669

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: YME1L1
• Synonyms: YME1L
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for BC019602, the custom clone sequence may differ by one or more nucleotides
  ATGTTTTCCTTGTCGAGCACGGTGCAACCCCAGGTTACAGTTCCTCTGAGTCATCTCATC
  AATGCCTTCCATACACCAAAAAACACTTCTGTTTCTCTCAGTGGAGTGTCAGTTTCTCAA
  AACCAGCATCGAGATGTAGTTCCTGAGCATGAGGCTCCCAGCAGTGAGTGTATGTTCAGT
  GACTTCCTGACGAAGCTTAACATTGTTTCAATTGGCAAAGGAAAAATATTCGAAGGGTAC
  AGATCCATGTTCATGGAGCCAGCAAAAAGGATGAAGAAGAGCTTGGACACAACCGATAAC
  TGGCACATCCGTCCAGAACCCTTCTCCCTCTCAATCCCTGTACACTGCGGGTTTCTCCAA
  ATGCCTATTGTCTATGATTTGTTTTGTCCATCGTTCTTAGTCACGGCT
  
• Restriction Sites: Please inquire
• ACCN: BC019602
• ORF Size: 411 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: BC019602.1, AAH19602.1
• RefSeq Size: 2563
• RefSeq ORF: 411
• Locus ID: 10730
• Protein Families: Druggable Genome, Protease
• Gene Summary: The protein encoded by this gene is the human ortholog of yeast mitochondrial AAA metalloprotease, Yme1p. It is localized in the mitochondria and can functionally complement a yme1 disruptant yeast strain. It is proposed that this gene plays a role in mitochondrial protein metabolism and could be involved in mitochondrial pathologies. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]