PBLD (AK092826) Human Untagged Clone

CAT#: SC312066

(untagged)-Human cDNA FLJ35507 fis, clone SMINT2009468, moderately similar to Human mawbp mRNA for MAWD binding protein

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PBLD
• Synonyms: HEL-S-306|MAWBP|MAWDBP
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for AK092826, the custom clone sequence may differ by one or more nucleotides
  ATGAAGCTTCCTATTTTCATAGCAGATGCATTCACAGCAAGAGCATTTTGTGGGAATCCT
  GCTGCTGTTTGCCTCCTAGAAAATGAATTGGATGAAGACATGCATCAGAAAATTGCAAGG
  GAGATGAACCTCTCTGAAACTGCTTTTATCCGAAAACTGCACCCGACAGACAACTTTGCA
  CAAAAAAACATGAATAGCACGCTCACGTTTGTCACTCTGAGTGGAGAACTAAGGGCCAGA
  CGAGCAGAGGATGGCATCGTCCTGGACTTGCCTCTTTATCCAGCCCACCCCCAGGACTTC
  CATGAAGTAGAGGACTTGATAAAGACTGCCATAGGCAACACACTGGTCCAGGACATCTGT
  TATTCTCCAGATACCCAAAAGCTCCTCGTCCGCCTCAGTGACGTTTACAACAGG
  
• Restriction Sites: Please inquire
• ACCN: AK092826
• ORF Size: 417 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: AK092826.1, BAC03986.1
• RefSeq Size: 2465
• RefSeq ORF: 417
• Locus ID: 64081
• Domains: PhzC-PhzF
• Gene Summary: Belongs to the PhzF family. [UniProtKB/Swiss-Prot Function]