MRPL42 (NM_172178) Human Untagged Clone

CAT#: SC312098

MRPL42 (untagged)-Human mitochondrial ribosomal protein L42 (MRPL42), nuclear gene encoding mitochondrial protein, transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MRPL42
• Synonyms: HSPC204; MRP-L31; MRPL31; MRPS32; PTD007; RPML31
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_172178, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGTGATGTCAAAGAGAACTATCTTGAAACATTTATTTCCAGTCCAAAATTCGGGCGTACATGTGCAG
  ATGGAGCTTTATATTGTGTTTGTCATAAATCTACGTATTCTCCTCTACCAGATGACTATAATTGCAACGT
  AGAGCTTGCTCTGACTTCTGATGGCAGGACAATAGTATGCTACCACCCTTCTGTGGACATTCCATATGAA
  CACACAAAACCTATCCCTCGGCCAGATCCTGTGCATAATAATGAAGAAACACATGATCAAGTGCTGAAAA
  CCAGATTGGAAGAAAAAGTTGAACACCTTGAGGAAGGACCTATGATAGAACAACTTAGCAAAATGTTCTT
  TACTACTAAGCACCGTTGGTATCCTCATGGACGGTATCACAGATGTCGTAAGAATCTGAATCCTCCAAAA
  GACAGATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_172178
• ORF Size: 429 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_172178.2, NP_751918.1
• RefSeq Size: 2042
• RefSeq ORF: 429
• Locus ID: 28977
• Gene Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a protein identified as belonging to both the 28S and the 39S subunits. Alternative splicing results in multiple transcript variants. Pseudogenes corresponding to this gene are found on chromosomes 4q, 6p, 6q, 7p, and 15q. [provided by RefSeq, May 2011]
  Transcript Variant: This variant (3) differs in the 5' UTR and internal coding region compared to variant 1. It encodes isoform b, which is the same length as isoform a, but it has a different N-terminus.