BLOC1S2 (NM_173809) Human Untagged Clone

CAT#: SC312099

BLOC1S2 (untagged)-Human biogenesis of lysosomal organelles complex-1, subunit 2 (BLOC1S2), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BLOC1S2
• Synonyms: BLOS2; BORCS2; CEAP; CEAP11
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_173809, the custom clone sequence may differ by one or more nucleotides
  ATGGCGGCGGCAGCCGAGGGCGTACTGGCGACCCGGAGTGATGAGCCCGCCCGAGACGAT
  GCCGCCGTGGAGACAGCTGAGGAAGCAAAGGAGCCTGCTGAAGCTGACATCACTGAGCTC
  TGCCGGGACATGTTCTCCAAAATGGCCACTTACCTGACTGGGGAACTGACGGCCACCAGT
  GAAGACTATAAGCTCCTGGAAAATATGAATAAACTCACCAGCTTGAAGTATCTTGAAATG
  AAAGATATTGCTATAAACATTAGTAGGAACTTAAAGGACTTAAACCAGAAATATGCTGGA
  CTGCAGCCTTATCTGGATCAGATCAATGTCATTGAAGAGCAGGTAGCAGCTCTTGAGCAG
  GCAGCTTACAAGTTGGATGCATATTCAAAAAAACTGGAAGCCAAGTACAAGAAGCTGGAG
  AAGCGA
  
• Restriction Sites: Please inquire
• ACCN: NM_173809
• ORF Size: 429 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_173809.2, NP_776170.2
• RefSeq Size: 1958
• RefSeq ORF: 429
• Locus ID: 282991
• Gene Summary: This gene encodes a protein with multiple functions. The encoded protein has been found in association with the centrosome, shown to co-localize with gamma-tubulin, and also found to be one of the proteins in the BLOC-1 complex which functions in the formation of lysosome-related organelles. A pseudogene of this gene is located on the X chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
  Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.