GFM1 (AK022724) Human Untagged Clone

CAT#: SC312108

(untagged)-Human cDNA FLJ12662 fis, clone NT2RM4002205, moderately similar to ELONGATION FACTOR G, MITOCHONDRIAL PRECURSOR

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GFM1
• Synonyms: COXPD1; EFG; EFG1; EFGM; EGF1; GFM; hEFG1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for AK022724, the custom clone sequence may differ by one or more nucleotides
  ATGTTTCTGGAAGAAAAAATCCCCTCGATTTCTGATTTAAAGCTAGCAATTCGAAGAGCT
  ACTCTGAAAAGATCATTTACTCCTGTATTTTTGGGAAGCGCCTTGAAGAACAAAGGAGTT
  CAGCCTCTTTTAGATGCTGTTTTAGAATACCTCCCAAATCCATCTGAAGTCCAGAACTAT
  GCTATTCTCAATAAAGAGGATGACTCAAAAGAGAAAACCAAAATCCTAATGAACTCCAGT
  AGAGACAATTCCCACCCATTTGTAGGCCTGGCTTTTAAACTGGAGTTTTTGTCTAGGTCC
  TTTTTCCGTCTCACTAGACAGAAGGACCACAGAAGGCCCATCCAGAGGACCACGTTATAT
  TTGATTGTCATGTCTCCTTATGATCTCCTAGGCTGTAATAGTTTCTTAGACTTTCCTTGT
  TTCTCACGAGAT
  
• Restriction Sites: Please inquire
• ACCN: AK022724
• ORF Size: 435 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: AK022724.1, BAB14205.1
• RefSeq Size: 2008
• RefSeq ORF: 435
• Locus ID: 85476
• Gene Summary: Eukaryotes contain two protein translational systems, one in the cytoplasm and one in the mitochondria. Mitochondrial translation is crucial for maintaining mitochondrial function and mutations in this system lead to a breakdown in the respiratory chain-oxidative phosphorylation system and to impaired maintenance of mitochondrial DNA. This gene encodes one of the mitochondrial translation elongation factors. Its role in the regulation of normal mitochondrial function and in different disease states attributed to mitochondrial dysfunction is not known. [provided by RefSeq, Jul 2008]