TMEM107 (NM_032354) Human Untagged Clone

CAT#: SC312137

TMEM107 (untagged)-Human transmembrane protein 107 (TMEM107), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TMEM107
• Synonyms: GRVS638; JBTS29; MKS13; PRO1268
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_032354, the custom clone sequence may differ by one or more nucleotides
  ATGGGCCGGGTCTCAGGGCTTGTGCCCTCTCGCTTCCTGACGCTCCTGGCGCATCTGGTG
  GTCGTCATCACCTTATTCTGGTCCCGGGACAGCAACATACAGGCCTGCCTGCCTCTCACG
  TTCACCCCCGAGGAGTATGACAAGCAGGACATTCATCCACTTCCTCTCTGCAGGCTGGTG
  GCCGCGCTCTCTGTCACCCTGGGCCTCTTTGCAGTGGAGCTGGCCGGTTTCCTCTCAGGA
  GTCTCCATGTTCAACAGCACCCAGAGCCTCATCTCCATTGGGGCTCACTGTAGTGCATCC
  GTGGCCCTGTCCTTCTTCATATTCGAGCGTTGGGAGTGCACTACGTATTGGTACATTTTT
  GTCTTCTGCAGTGCCCTTCCAGCTGTCACTGAAATGGCTTTATTCGTCACCGTCTTTGGG
  CTGAAAAAGAAACCCTTC
  
• Restriction Sites: Please inquire
• ACCN: NM_032354
• ORF Size: 441 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_032354.2, NP_115730.2
• RefSeq Size: 1533
• RefSeq ORF: 441
• Locus ID: 84314
• Protein Families: Transmembrane
• Gene Summary: This gene encodes a transmembrane protein and component of the primary cilia transition zone. The encoded protein regulates ciliogenesis and ciliary protein composition. Human fibroblasts expressing a mutant allele of this gene exhibit reduced numbers of cilia, altered cilia length, and impaired sonic hedgehog signaling. In human patients, different mutations in this gene cause different ciliopathies, including Meckel-Gruber syndrome and orofaciodigital syndrome. [provided by RefSeq, May 2017]
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.