MPDU1 (AF258568) Human Untagged Clone

CAT#: SC312141

(untagged)-Human PP3958 mRNA, complete cds

SDS

Reconstitution Protocol

USD 960.00

3 Weeks*

Size
    • 10 ug
Bulk Requests & Clone Modifications

Product Images

Other products for "MPDU1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MPDU1
Synonyms CDGIF|HBEBP2BPA|Lec35|My008|PP3958|PQLC5|SL15
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for AF258568, the custom clone sequence may differ by one or more nucleotides
ATGGGAAGAGCTCAGGTGACAGAGCCAAAGGTCTCAACTCCTCCCCTAGCTTCTCCAGGC
AGCCACCAACTACCACAACGGGCACACAGGCCAGCTCTCAGCCATCACAGTCTTCCTGCT
GTTTGGGGGCTCCCTGGCCCGAATCTTCACTTCCATTCAGGAAACCGGAGATCCCCTGAT
GGCTGGGACCTTTGTGGTCTCCTCTCTCTGCAACGGCCTCATCGCCGCCCAGCTGCTCTT
CTACTGGAATGCAAAGCCTCCCCACAAGCAGAAAAAGGCGCAGTAGAGCCAGCTACTGGA
GTCATTCCGTTTCCACTCATTCACCCAACCTCAGGGTTCTCCCCATCTGAGCCAGCCTGC
TGGTGTGACTTACTCATCCTCCATTCCTCTGCACTTGCAGACTTTCTGAGCCAGGGTTTT
CTTTTAGTGGAAACAAATGGT
Restriction Sites Please inquire     
ACCN AF258568
ORF Size 444 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq AF258568.1, AAG23771.1
RefSeq Size 1643
RefSeq ORF 444
Locus ID 9526
Protein Families Transmembrane
Gene Summary This gene encodes an endoplasmic reticulum membrane protein that is required for utilization of the mannose donor mannose-P-dolichol in the synthesis of lipid-linked oligosaccharides and glycosylphosphatidylinositols. Mutations in this gene result in congenital disorder of glycosylation type If. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.