MEG3 (AK055725) Human Untagged Clone

CAT#: SC312146

(untagged)-Human cDNA FLJ31163 fis, clone KIDNE1000050

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MEG3
• Synonyms: FP504|GTL2|LINC00023|NCRNA00023|PRO0518|PRO2160|onco-lncRNA-83|prebp1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for AK055725, the custom clone sequence may differ by one or more nucleotides
  ATGAGAAGACTTTCAATAGTAATGAAGAATCCATGGCACTCTCCTCACCCTCAAACACAT
  GGCAGTCATTCACATACAGGCCCCAAAGCCACTGTTAGTGCTGCAGTAGCTCCTGTGGAC
  ATTGGAAAGCCCGGAGAGGGCGTGGAAGAAATCAGCTGGCCCCCGGCAGGTTCTCTGGGG
  TTTTGTGCCCAAGGCTCCTGGAGCCCTAAAAACTTTCAAAAGTTAACTCCCCACGTCCCC
  ATCCTGCTTGGGTTTCTGGACTTTTCTGAGGCACCGGCAGAGGGGTCTCGTTGCTCCCTT
  GAGTGTAGGGGCAGCCCTTTAACCTGGCTCCTTGAGTCCCTGCTTTTTCTGCTTCTGTTG
  CCTTCTTCCTCGTCTTCCTCTCTCTCAATATCTCCCTCTCTTTGTCCCTCCCCAGTTCCT
  GACCTGGCCATCCCGGGGTGCCCT
  
• Restriction Sites: Please inquire
• ACCN: AK055725
• ORF Size: 447 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: AK055725.1, BAB70996.1
• RefSeq Size: 2861
• RefSeq ORF: 447
• Locus ID: 55384
• Gene Summary: This gene is a maternally expressed imprinted gene. Multiple alternatively spliced transcript variants have been transcribed from this gene and all of them are long non-coding RNAs (lncRNAs). This gene is expressed in many normal tissues, but its expression is lost in multiple cancer cell lines of various tissue origins. It inhibits tumor cell proliferation in vitro. It also interacts with the tumor suppressor p53, and regulates p53 target gene expression. Its deletion enhances angiogenesis in vivo. Many experimental evidences demonstrate that this gene is a lncRNA tumor suppressor. [provided by RefSeq, Mar 2012]