ITGB1BP1 (NM_022334) Human Untagged Clone

CAT#: SC312162

ITGB1BP1 (untagged)-Human integrin beta 1 binding protein 1 (ITGB1BP1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ITGB1BP1
• Synonyms: ICAP-1A; ICAP-1alpha; ICAP-1B; ICAP1; ICAP1A; ICAP1B
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_022334, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTTTCGCAAGGGCAAAAAACGACACAGTAGTAGCAGTTCCCAAAGTAGCGAAATCAGTACTAAGAGCA
  AGTCTGTGGATTCTAGCCTTGGGGGTCTTTCACGATCCAGCACTGTGGCCAGCCTCGACACAGATTCCAC
  CAAAAGCTCAGGACAAAGCAACAATAATTCAGATACCTGTGCAGAATTTCGAATAAAATATGTTGGTGCC
  ATTGAGAAACTGAAACTCTCCGAGGGAAAAGGCCTTGAAGGGCCATTAGACCTGATAAATTATATAGACG
  TTGCCCAGCAAGATGGAAAGTTGCCTTTTGTTCCTCCGGAGGAAGAATTTATTATGGGAGTTTCCAAGTA
  TGGCATAAAAGTATCAACATCAGATCAATATGAACAAGCACAAGCCATTTGCAAGGTTTTATCCACCGCT
  TTTGACTCTGTATTAACATCTGAGAAACCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_022334
• ORF Size: 453 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_022334.4, NP_071729.1
• RefSeq Size: 1855
• RefSeq ORF: 453
• Locus ID: 9270
• Gene Summary: The cytoplasmic domains of integrins are essential for cell adhesion. The protein encoded by this gene binds to the beta1 integrin cytoplasmic domain. The interaction between this protein and beta1 integrin is highly specific. Two isoforms of this protein are derived from alternatively spliced transcripts. The shorter form of this protein does not interact with the beta1 integrin cytoplasmic domain. The longer form is a phosphoprotein and the extent of its phosphorylation is regulated by the cell-matrix interaction, suggesting an important role of this protein during integrin-dependent cell adhesion. Several transcript variants, some protein-coding and some non-protein coding, have been found for this gene. [provided by RefSeq, Jan 2016]
  Transcript Variant: This variant (2) differs in the 5' UTR and lacks an alternate in-frame exon compared to variant 3. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.