MSI2 (BC017560) Human Untagged Clone

CAT#: SC312172

MSI2 (untagged)-Human cDNA clone MGC:9644 IMAGE:3922563, complete cds

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MSI2
• Synonyms: FLJ36569; MGC3245; MSI2H; musashi 2; musashi homolog 2 (Drosophila)
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for BC017560, the custom clone sequence may differ by one or more nucleotides
  ATGGTCACAAGAACAAAGAAAATATTTGTAGGCGGGTTATCTGCGAACACAGTAGTGGAA
  GATGTAAAGCAATATTTCGAGCAGTTTGGCAAGGTGGAAGATGCAATGCTGATGTTTGAT
  AAAACTACCAACAGGCACAGAGGGTTTGGCTTTGTCACTTTTGAGAATGAAGATGTTGTG
  GAGAAAGTCTGTGAGATTCATTTCCATGAAATCAATAATAAAATGGTAGAATGTAAGAAA
  GCTCAGCCGAAAGAAGTCATGTTCCCACCTGGGACAAGAGGCCGGGCCCGGGGACTGCCT
  TACACCATGGACGCGTTCATGCTTGGCATGGGGATGCTGGGATATCCCAACTTCGTGGCG
  ACCTATGGCCGTGGCTACCCCGGATTTGCTCCAAGCTATGGCTATCAGTTCCCAGACTAT
  TTGCCGGTTTCACAAGACATAATTTTTATCAAC
  
• Restriction Sites: Please inquire
• ACCN: BC017560
• ORF Size: 456 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: BC017560.1, AAH17560.1
• RefSeq Size: 1672
• RefSeq ORF: 456
• Locus ID: 124540
• Domains: RRM
• Gene Summary: This gene encodes an RNA-binding protein that is a member of the Musashi protein family. The encoded protein is transcriptional regulator that targets genes involved in development and cell cycle regulation. Mutations in this gene are associated with poor prognosis in certain types of cancers. This gene has also been shown to be rearranged in certain cancer cells. [provided by RefSeq, Apr 2016]