MIA40 (CHCHD4) (NM_144636) Human Untagged Clone

CAT#: SC312197

CHCHD4 (untagged)-Human coiled-coil-helix-coiled-coil-helix domain containing 4 (CHCHD4), nuclear gene encoding mitochondrial protein, transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CHCHD4
• Synonyms: MIA40; TIMM40
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_144636, the custom clone sequence may differ by one or more nucleotides
  ATGCCTGTGTCGTATTCATCTGTGACCACCAGGTACTACCACAGAGCTGGAGCTGAGGAA
  GGGAAGGATCGAATCATATTTGTAACCAAAGAAGATCATGAAACTCCAAGCAGTGCAGAA
  TTGGTGGCTGATGACCCCAACGATCCATACGAGGAGCATGGATTGATACTGCCAAATGGA
  AACATTAACTGGAACTGCCCATGCCTTGGGGGAATGGCCAGCGGTCCCTGTGGAGAACAG
  TTTAAGTCAGCCTTTTCCTGCTTCCACTATAGCACGGAGGAGATCAAGGGGTCAGACTGT
  GTAGACCAGTTCCGGGCCATGCAGGAATGCATGCAGAAATACCCAGACCTCTATCCCCAA
  GAGGATGAGGATGAGGAAGAGGAAAGAGAGAAGAAGCCAGCAGAACAAGCAGAAGAAACA
  GCTCCCATTGAGGCCACTGCAACCAAAGAAGAGGAGGGATCAAGT
  
• Restriction Sites: Please inquire
• ACCN: NM_144636
• ORF Size: 468 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_144636.1, NP_653237.1
• RefSeq Size: 1549
• RefSeq ORF: 468
• Locus ID: 131474
• Gene Summary: CHCHD4, a component of human mitochondria, belongs to a protein family whose members share 6 highly conserved cysteine residues constituting a -CXC-CX(9)C-CX(9)C- motif in the C terminus (Hofmann et al., 2005 [PubMed 16185709]). [supplied by OMIM, Mar 2008]
  Transcript Variant: This variant (2) contains an alternate segment for the 5' coding region and uses a downstream start codon, compared to variant 1. Variant 2 is found at a much lower frequency than variant 1. The predicted protein (isoform 2) is longer and has a distinct and longer N-terminus, compared to isoform 1.